thiO

thiO
168

FAD-dependent glycine oxidase

locus
BSU_11670
Molecular weight
40.78 kDa
pI
5.9
Protein length
Gene length
function
biosynthesis of thiamine
product
glycine oxidase
essential
no
ec
1.4.3.19
synonyms
thiO, goxB, yjbR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0665

This gene is a member of the following regulons

Gene
Coordinates
1,243,735  1,244,844
The protein
Catalyzed reaction/ biological activity
glycine + H2O + O2 --> glyoxylate + H2O2 + NH4+ (according to UniProt)
H2O + N-ethylglycine + O2 --> ethylamine + glyoxylate + H2O2 (according to UniProt)
H2O + O2 + sarcosine --> glyoxylate + H2O2 + methylamine (according to UniProt)
D-alanine + H2O + O2 --> H2O2 + NH4+ + pyruvate (according to UniProt)
glyphosate + H2O + O2 --> aminomethylphosphonate + glyoxylate + H+ + H2O2 (according to UniProt)
Protein family
DAO family (single member, according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|1NG3] (complex with acetyl-glycine),  [PDB|1RYI]
[AF|O31616]
Modification
FAD [Pubmed|19751796]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
description
[Pubmed|1898926]
regulation
repressed by thiamine ([wiki|Thi-box]) [Pubmed|16356850]
the [wiki|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [wiki|RNA switch], via [wiki|RNA switch], in [regulon|protein:E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
Open in new tab

[gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]→[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]

2022-11-24 21:30:20

Jstuelk

28

a48634f4963321f6f5f59c5107f472325227a1b0

A1FEA45B91FD65F137EB4D1A0FCD88BC91331EAF

Biological materials
Mutant
MGNA-B164 (yjbR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1163 NBRP B. subtilis, Japan]
BKE11670 ([gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTCCGCCTCCAATCACCA,  downstream forward: _UP4_CGCAAGGAGGCGGTTCAGAT
BKK11670 ([gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTCCGCCTCCAATCACCA,  downstream forward: _UP4_CGCAAGGAGGCGGTTCAGAT
References
Reviews
19348578,10382260
Original Publications
19254749,11744710,12654003,9827558,12627963,15105420,19751796,19864430,14567704,20690620,24925096,31562850

87B5C84B7EE10F60B545CCFEF6A527A546B80432

Page visits: 1348

Time of last update: 2022-11-29 02:19:20

Author of last update: Jstuelk