gltC

gltC
168

transcriptional activator/ repressor of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon, activates expression of the operon in the absence of arginine, represses in the presence of glutamate

locus
BSU_18460
Molecular weight
33.87 kDa
pI
5.62
Protein length
Gene length
function
regulation of the glutamate synthase operon ([gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB])
product
transcriptional regulator ([wiki|LysR family])
essential
No
synonyms
gltC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0583

This gene is a member of the following regulons

Gene
Coordinates
2,014,779  2,015,681
Phenotypes of a mutant
''gltC'' mutants  are auxotrophic for glutamate, this can be suppressed by the [gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]24 mutation or by amplification of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] genomic region [pubmed|9023181,28294562]
The protein
Catalyzed reaction/ biological activity
transcription activation of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon [Pubmed|2548995]
Protein family
[wiki|LysR family] (according to UniProt) [Pubmed|2548995]
[wiki|Domains]
DNA-binding helix-turn-helix motif: AA 18 ... 37
[wiki|HTH lysR-type domain] (aa 1-58) (according to UniProt)
Structure
[PDB|2H99] (from Acinetobacter baylyi, corresponds to aa 1 - 245, 35% identity) [pubmed|19400783]
[AF|P20668]
Effectors of protein activity
2-oxoglutarate stimulates transcription activation, glutamate inhibits transcription activation [Pubmed|17134717]
Expression and Regulation
Operons
genes
[gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]
description
[Pubmed|22383849]
regulation
autoregulation by GltC [Pubmed|2548995]
regulatory mechanism
[protein|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]: auto-repression, [Pubmed|2548995], in [regulon|protein:87BCAE725B02860156D50E1783F6DB68510C811E|gltC regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2548995], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]

2022-11-22 08:04:16

Jstuelk

11

47b8224b2cb98c4863d9f0e367d04738caebb414

07014BDC6B59458B19B9380881DDFDD140BA5101

Biological materials
Mutant
GP344 (erm), (available in [wiki|Jörg Stülke]'s lab)
GP738 (gltC::Tn10, spc), (available in [wiki|Jörg Stülke]'s lab)
GP1904 (''gltC''::''aphA3''), (available in [wiki|Jörg Stülke]'s lab) [pubmed|28294562]
BKE18460 ([gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACATCCAT,  downstream forward: _UP4_TAAAAAAAATGAACCCGAGC
BKK18460 ([gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACATCCAT,  downstream forward: _UP4_TAAAAAAAATGAACCCGAGC
Expression vectors
for expression, purification in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP903,  available in [wiki|Jörg Stülke]'s lab
for expression, purification in ''E. coli'' with C-terminal Strep-tag, in pET3C: pGP951,  available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
Antibody
available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
[wiki|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
[wiki|Fabian Commichau] Senftenberg, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
References
Reviews
20408793,22625175
Original Publications
7559360,15150225,2548995,17183217,17608797,17134717,14523131,20630473,25711804,28294562,19400783,31649652

87BCAE725B02860156D50E1783F6DB68510C811E

Page visits: 5248

Time of last update: 2022-11-30 10:43:16

Author of last update: Jstuelk