spoIVFB

spoIVFB
168

intramembrane metalloprotease (site 2 protease), processing of pro-sigma-K to active [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]

locus
BSU_27970
Molecular weight
33.49 kDa
pI
8.48
Protein length
Gene length
function
processing of pro-sigma-K to active [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]
product
intramembrane metalloprotease
essential
no
synonyms
spoIVFB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,855,973  2,856,839
The protein
Catalyzed reaction/ biological activity
processing of pro-sigma-K to active [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] [Pubmed|19805276]
Protein family
[wiki|peptidase M50B family] (according to UniProt)
[wiki|Domains]
C-terminal [wiki|CBS domain], this domain binds ATP [Pubmed|19805276]
[wiki|Cofactors]
Zn2+ [pubmed|35007155]
Structure
[AF|P26937]
Effectors of protein activity
ATP regulates substrate access to the active site and renders cleavage sensitive to the cellular energy level [Pubmed|19805276]
[protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB] is kept inactive by the interaction with [protein|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA] and [protein|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA] [pubmed|35471152,15087499]
[wiki|Localization]
mother cell integral membrane protein [Pubmed|24243021,11959848]
Expression and Regulation
Operons
genes
[gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]-[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]
description
[Pubmed|1942049]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE], [wiki|SpoIIID]) [Pubmed|15699190,1942049,15383836]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,1942049], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
additional information
the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
Open in new tab

[gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]→[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]

2022-12-30 13:20:31

ghost

38

1e707d7d278101558953739cad5b8518a0b41b6f

06855E0F0D4DD201392A356E8A25510E179CA137

genes
[gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]-[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]-[gene|11927EB0448839D047EC7BF70EC65156DAB481D3|rplU]-[gene|B27548A4BBF396C9BA102A80ACB08B21262CEA30|prp]-[gene|4626C659D6F1A81CCC94030F1CBAF7FEC3DE19CA|rpmA]
description
[Pubmed|22383849]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE], [wiki|SpoIIID]) [Pubmed|15699190,1942049,15383836]
additional information
the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
Open in new tab

[gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]→[gene|4626C659D6F1A81CCC94030F1CBAF7FEC3DE19CA|rpmA]

2022-12-30 13:20:33

ghost

52

08f2f6d702f3f60218799ff9efc97a2139d25593

976520A55B5743F327D2763CEA04F353CE09CEE1

Biological materials
Mutant
BKE27970 ([gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE27970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATCTTTAAGATAAGGTCGA,  downstream forward: _UP4_TAAAACTGATTGACAAACGC
BKK27970 ([gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK27970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATCTTTAAGATAAGGTCGA,  downstream forward: _UP4_TAAAACTGATTGACAAACGC
References
Reviews
20836086,23479438,19189971,24099006,31350897,33538382,34410368,35638784
Original Publications
11959848,9501233,12940997,1577688,12060714,9078383,1942049,10611287,15383836,16818230,19805276,15699190,23585539,23995631,15087499,24243021,22383849,26953342,29180425,30403663,32515031,35007155,35471152

8801B095C2CE36F3E0B9DBBF489FFB217087DC0A

Page visits: 2146

Time of last update: 2023-02-01 11:31:11

Author of last update: Jstuelk