salA

salA
168

negative regulator of [gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC] expression, activator of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA] kinase activity

locus
BSU_01540
Molecular weight
38.48 kDa
pI
5.23
Protein length
Gene length
function
control of alkaline protease expression
product
MRP family regulator
essential
no
synonyms
salA, ybaL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0489

This gene is a member of the following regulons

Gene
Coordinates
157,421  158,479
Phenotypes of a mutant
increased expression of ''[gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]'' (due to loss of repression of ''[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]'' expression)
The protein
Catalyzed reaction/ biological activity
transcription repression of ''[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]'' expression [wiki|26094643]
Protein family
Mrp/NBP35 ATP-binding proteins family (single member, according to UniProt)
[wiki|Domains]
DNA-binding domain: aa 1 - 60 [Pubmed|26094643]
ATP-binding Walker domain: aa 105 - 275 [Pubmed|26094643]
domain for the interaction with [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]: aa 294 - 352
Structure
[PDB|4V03] (MinD from Aquifex aeolicus, corresponds to C-terminal domain, aa 109 ... 344, 28% identity) [pubmed|25500731]
[AF|P50863]
Modification
[protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-dependent phosphorylation at Tyr-327 results in better binding of the target promoter [Pubmed|26094643]
Expression and Regulation
Operons
genes
[gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]
description
[pubmed|22383849]
regulatory mechanism
[protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]: repression, in [regulon|protein:8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA regulon]
Open in new tab

[gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]

2022-11-26 01:49:40

Bzhu

18

08202f127813ccabafb58b39507cc5796a50a4b9

906C5D4C503D12520525B152C613A2DDE709A5EC

Biological materials
Mutant
1A919 ( ''salA''::''erm''), [Pubmed|15126467], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A919&Search=1A919 BGSC]
BKE01540 ([gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCTCACCCTTTTG,  downstream forward: _UP4_TAAAAGGTGAACCGGGATTC
BKK01540 ([gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCTCACCCTTTTG,  downstream forward: _UP4_TAAAAGGTGAACCGGGATTC
References
15126467,26286503,26094643,27725816,25500731

8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471

Page visits: 2412

Time of last update: 2022-11-27 10:32:30

Author of last update: Melvin.boenninger