ylaJ

ylaJ
168

spore lipoprotein

locus
BSU_14800
Molecular weight
23.24 kDa
pI
4.83
Protein length
Gene length
function
efficient spore [wiki|germination]
product
unknown
essential
no
synonyms
ylaJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5912

This gene is a member of the following regulons

Gene
Coordinates
1,548,681  1,549,310
Phenotypes of a mutant
reduced rate of spore [wiki|germination] in L-alanine [pubmed|28333204]
The protein
Structure
[AF|O07634]
[wiki|Localization]
forespore inner membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|8853C1792A12D9F146FFDC407B6DDD82740EDEA8|ylaJ]
description
[Pubmed|12480901]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|12480901]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|12480901], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|8853C1792A12D9F146FFDC407B6DDD82740EDEA8|ylaJ]

2022-12-22 06:12:55

ghost

25

210d1dfb28c75d4b994441495742d805942fec65

C47F51B10F95D554B2B831A9AFD0806955B75BF8

Biological materials
Mutant
MGNA-A539 (ylaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/539 NBRP B. subtilis, Japan]
BKE14800 ([gene|8853C1792A12D9F146FFDC407B6DDD82740EDEA8|ylaJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTGCGGGTTCCCTCCTT,  downstream forward: _UP4_TAAGCTATAGCCTTGCGCTT
BKK14800 ([gene|8853C1792A12D9F146FFDC407B6DDD82740EDEA8|ylaJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTGCGGGTTCCCTCCTT,  downstream forward: _UP4_TAAGCTATAGCCTTGCGCTT
References
12107147,12480901,28333204

8853C1792A12D9F146FFDC407B6DDD82740EDEA8

Page visits: 1181

Time of last update: 2023-02-02 08:01:01

Author of last update: Melvin.boenninger