hemX

hemX
168

negative effector of the concentration of [protein|B1413EB525000744BE8E429E760220A13BC4530D|hemA]

locus
BSU_28160
Molecular weight
31.89 kDa
pI
9.28
Protein length
Gene length
function
heme biosynthesis
product
regulatory protein, protease?
essential
no
synonyms
hemX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0755

This gene is a member of the following regulons

Gene
Coordinates
2,876,928  2,877,758
The protein
Structure
[AF|P16645]
Expression and Regulation
Operons
genes
[gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]-[gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]-[gene|D266E22E07B849E2AEB0EF232C49A2FE1EA4E02B|hemC]-[gene|33459D4389F85D60311FCE770BBA0ED9802BA342|hemD]-[gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]-[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]
description
[Pubmed|1672867]
regulation
induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
regulatory mechanism
[protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]: repression, [Pubmed|11532148], in [regulon|protein:00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1672867], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]→[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]

2022-06-23 23:22:23

ghost

23

64840dd729762069005c4bd541ed0ddec6e74ace

168BC8B91CBFE3EA050DA8A9187C8C67D6BBE4F9

Biological materials
Mutant
BKE28160 ([gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCAGTATCAATCATTC,  downstream forward: _UP4_TAAACGATGTCCCAAGCAGA
BKK28160 ([gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCAGTATCAATCATTC,  downstream forward: _UP4_TAAACGATGTCCCAAGCAGA
References
10217486,1672867,8012594,11532148

88616BA1E853E11BE0CB18F06287CA4C68143148

Page visits: 1525

Time of last update: 2022-06-25 20:27:07

Author of last update: Bzhu