cypC

cypC
168

long chain-fatty acid beta-hydroxylating cytochrome P450, H(2)O(2)-dependent, hydroxylates myristic acid to beta-hydroxymyristic acid, required for protection against paraquat stress

locus
BSU_02100
Molecular weight
47.95 kDa
pI
6.47
Protein length
Gene length
function
biosynthesis of beta-hydroxy fatty acid for lipopeptides
product
fatty acid beta-hydroxylating cytochrome P450, protection against paraquat stress
essential
no
ec
null
synonyms
cypC, ybdT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2124

This gene is a member of the following regulons

Gene
Coordinates
229,525  230,778
The protein
Catalyzed reaction/ biological activity
hydroxylation of a long-chain fatty acid (e.g. myristic acid) at the alpha- and beta-positions using hydrogen peroxide as an oxidant [Pubmed|12519760]
1,2-saturated fatty acid + H2O2 --> 2-hydroxy fatty acid + H2O (according to UniProt)
2,3-saturated fatty acid + H2O2 --> 3-hydroxy fatty acid + H2O (according to UniProt)
Protein family
[wiki|cytochrome P450] family (according to UniProt)
Structure
[PDB|2ZQJ] [PDB|1IZO][Pubmed|12519760]
[AF|O31440]
Expression and Regulation
Operons
genes
[gene|88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205|cypC]
description
(according to [http://dbtbs.hgc.jp/COG/prom/cypC.html DBTBS]) null
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205|cypC]

2022-12-05 02:45:56

ghost

19

ae76bd79407946848abde61a3e08c7ed6beabb6d

345F0917AB91C404C4CF207B6194340F47AB77CA

Biological materials
Mutant
MGNA-B961 (ybdT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1960 NBRP B. subtilis, Japan]
BKE02100 ([gene|88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205|cypC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCGCTTACCCTGCCTTC,  downstream forward: _UP4_TAAATTAAAAAGCTCTCTTC
BKK02100 ([gene|88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205|cypC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCGCTTACCCTGCCTTC,  downstream forward: _UP4_TAAATTAAAAAGCTCTCTTC
References
12297285,11827534,11566026,17385817,11914497,10529095,12519760,15805528,23586998,20697922,21673922,22582280

88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205

Page visits: 2236

Time of last update: 2022-12-06 01:33:03

Author of last update: Melvin.boenninger