phrK

phrK
168

response regulator aspartate phosphatase ([protein|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK]) regulator, controls [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] activity

locus
BSU_18920
Molecular weight
3.98 kDa
pI
8.16
Protein length
Gene length
function
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] activity
product
phosphatase ([protein|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK]) regulator
essential
no
synonyms
phrK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,063,262  2,063,384
The protein
Catalyzed reaction/ biological activity
inhibits [protein|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK] activity [Pubmed|16816200]
Protein family
[wiki|phr family] (according to UniProt)
Structure
[AF|O31840]
Expression and Regulation
Operons
genes
[gene|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK]-[gene|886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E|phrK]
description
[Pubmed|11466295]
regulation
induced under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|25666134]
regulatory mechanism
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|25666134], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|11466295], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK]→[gene|886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E|phrK]

2022-08-30 13:03:58

ghost

14

8d895f48048c3161ae8450d01604896491e79a76

6598D6175EA141389297C4D92A255AF6C17C57FA

Biological materials
Mutant
BKE18920 ([gene|886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E|phrK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATAAGATTCCCTCCAC,  downstream forward: _UP4_TAAAAAAGGTTGATTAATTA
BKK18920 ([gene|886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E|phrK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATAAGATTCCCTCCAC,  downstream forward: _UP4_TAAAAAAGGTTGATTAATTA
References
11466295,16816200,20817675

886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E

Page visits: 1649

Time of last update: 2022-10-06 04:48:49

Author of last update: Melvin.boenninger