pdaA

pdaA
168

N-acetylmuramic acid deacetylase, spore cortex peptidoglycan synthesis

locus
BSU_07980
Molecular weight
29.92 kDa
pI
7.32
Protein length
Gene length
function
spore cortex peptidoglycan synthesis
product
N-acetylmuramic acid deacetylase
essential
no
synonyms
pdaA, yfjS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0726

This gene is a member of the following regulons

Gene
Coordinates
869,559  870,350
The protein
Catalyzed reaction/ biological activity
de-N-acetylation of N-acetylglucosamine and N-acetyl-muramic acid for spore cortex peptidoglycan [Pubmed|15687192]
Protein family
[wiki|polysaccharide deacetylase family] (according to UniProt)
[wiki|Domains]
[wiki|NodB homology domain] (aa 66-247) (according to UniProt)
Structure
[PDB|1W17] [pubmed|15251431]
[AF|O34928]
Expression and Regulation
Operons
genes
[gene|88E167795BBCB8529E322E3A4DC9965EA6AAA617|pdaA]
description
[Pubmed|12374835]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|12374835,15699190]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|12374835,15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|88E167795BBCB8529E322E3A4DC9965EA6AAA617|pdaA]

2022-12-29 09:57:09

ghost

20

83ed6beb6bf99803edf51e8db78894ad277c8f43

324161C7FFAE730B620CD93E09F2D90F78052798

Biological materials
Mutant
MGNA-C273 (yfjS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2271 NBRP B. subtilis, Japan]
BKE07980 ([gene|88E167795BBCB8529E322E3A4DC9965EA6AAA617|pdaA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGCCAGCGCTCCTTCTG,  downstream forward: _UP4_TAAAAGAGAAAGACCTCTCC
BKK07980 ([gene|88E167795BBCB8529E322E3A4DC9965EA6AAA617|pdaA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGCCAGCGCTCCTTCTG,  downstream forward: _UP4_TAAAAGAGAAAGACCTCTCC
References
12374835,15687192,15699190,15251431,14679227,24405365

88E167795BBCB8529E322E3A4DC9965EA6AAA617

Page visits: 2509

Time of last update: 2023-02-05 02:25:15

Author of last update: Melvin.boenninger