SubtiWiki SubtiWiki
yjdB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yjdB
168

unknown

locus
BSU_11990
Molecular weight
12.25 kDa
pI
10
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yjdB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,269,733  1,270,080
The protein
[wiki|Domains]
BIG2 domain (aa 36-114) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|890A1723F595FCF252E5E9EA3EE3A73204ADD8C1|yjdB]
description
[Pubmed|16291680]
regulation
expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|16291680]
regulatory mechanism
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|16291680], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|890A1723F595FCF252E5E9EA3EE3A73204ADD8C1|yjdB]

2021-12-17 05:25:30

ghost

5

1e55004658d87df8cfde0b19f2d321ac7182b97b

95C1B5033927098D36D71C218440DDE37C5879F1

Biological materials
Mutant
MGNA-A263 (yjdB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/263 NBRP B. subtilis, Japan]
BKE11990 ([gene|890A1723F595FCF252E5E9EA3EE3A73204ADD8C1|yjdB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAAACACTCCTTTA,  downstream forward: _UP4_TAATCTTTATCCGCCAGATT
BKK11990 ([gene|890A1723F595FCF252E5E9EA3EE3A73204ADD8C1|yjdB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAAACACTCCTTTA,  downstream forward: _UP4_TAATCTTTATCCGCCAGATT
References
16291680,20817675,25666134

890A1723F595FCF252E5E9EA3EE3A73204ADD8C1

Page visits: 1521

Time of last update: 2022-01-20 14:37:11

Author of last update: Melvin.boenninger