yfmG

yfmG
168

unknown

locus
BSU_07480
Molecular weight
56.37 kDa
pI
5.18
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yfmG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1262

This gene is a member of the following regulons

Gene
Coordinates
820,867  822,330
The protein
Structure
[PDB|2AFT] (human protein, corresponds to aa 205 ... 467, 25% identity) [pubmed|16368756]
[AF|O34722]
Modification
phosphorylated on Arg-474 [Pubmed|22517742]
Expression and Regulation
Operons
genes
[gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]
description
[Pubmed|21815947]
regulation
repressed by glucose (4-fold) [Pubmed|12850135]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|8A9E5A121CA2C5CE8A7A2DD2FDCE2AD5FCB356BF|yfmH]: attenuation, [pubmed|32611709], in [regulon|protein:8A9E5A121CA2C5CE8A7A2DD2FDCE2AD5FCB356BF|yfmH regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|32611709], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]' and '[protein|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]' [PubMed|20525796]
Open in new tab

[gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]

2022-12-01 11:05:32

Jstuelk

19

7DF294AC13CEB78E9FCB58ACB81C66FF6BD29A94

46527821CFF5BBBCB75FB343E492D2861DB04BA4

Biological materials
Mutant
MGNA-C243 (yfmG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2241 NBRP B. subtilis, Japan]
BKE07480 ([gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTACGATAACCTCCCG,  downstream forward: _UP4_TAATCATTCTAGGTTAGAGA
BKK07480 ([gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTACGATAACCTCCCG,  downstream forward: _UP4_TAATCATTCTAGGTTAGAGA
References
22517742,20817675,21815947,12850135,20525796,16368756,32611709,35171018

893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB

Page visits: 2672

Time of last update: 2022-12-01 09:22:15

Author of last update: Jstuelk