SubtiWiki SubtiWiki
yqgP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yqgP
168

intramembrane protease

locus
BSU_24870
Molecular weight
56.27 kDa
pI
5.51
Protein length
Gene length
function
cell division
product
intramembrane protease
essential
no
synonyms
yqgP, glpG, gluP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5010

This gene is a member of the following regulons

Gene
Coordinates
2,571,907  2,573,430
Phenotypes of a mutant
filamentous phenotype [Pubmed|15050034]
The protein
Catalyzed reaction/ biological activity
Cleaves type-1 transmembrane domains using a catalytic dyad composed of serine and histidine that are contributed by different transmembrane domains (according to UniProt)
cleavage of [protein|472E3A2407C83EEE26DB00079D185C4EA2988611|mgtE] between its first and second trans-membrane helix at low magnesium concentration or high manganese or zinc concentrations to prevent uptake of toxic metal ions [pubmed|31930742]
acts as adapter protein for [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH] [pubmed|31930742]
Protein family
[wiki|peptidase S54 family] (according to UniProt)
[wiki|Domains]
two [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Effectors of protein activity
Mn2+ and Zn2+ bind to the N-terminal cytosolic domain of YqgE to stimulate [protein|472E3A2407C83EEE26DB00079D185C4EA2988611|mgtE] degradation [pubmed|31930742]
Paralogous protein(s)
[protein|D941248711FEB7F3698AF7B02EED95722605CF72|ydcA], Array
[wiki|Localization]
cell membrane [Pubmed|22921757]
Expression and Regulation
Operons
genes
[gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]-[gene|C44F6723A2F1A627A0B9042871A07F5365D6121A|yqgO]-[gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]-[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]
description
[pubmed|22383849]
additional information
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
Open in new tab

[gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]→[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]

2021-12-25 16:48:28

Jstuelk

10

a1ca89060787c1fe2f14ef34abd6ea4555e517f1

27E8D0EE2E860F577FC79AA0ADCE162D21DD5DD4

Biological materials
Mutant
MGNA-C445 (yqgP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2443 NBRP B. subtilis, Japan]
BKE24870 ([gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACCGCTCCAATAG,  downstream forward: _UP4_TAGAGGTGGAATATGGAAAG
BKK24870 ([gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACCGCTCCAATAG,  downstream forward: _UP4_TAGAGGTGGAATATGGAAAG
References
Reviews
19421188,23518036,34410368
Original Publications
15050034,22921757,15616571,31930742

89C51789FBB2EE86771ABD8629FD99748ED5D4EF

Page visits: 1013

Time of last update: 2022-01-25 04:29:36

Author of last update: Jstuelk