ylyA

ylyA
168

modulator of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]-containing [wiki|RNA polymerase]

locus
BSU_15440
Molecular weight
16.63 kDa
pI
5.79
Protein length
Gene length
function
control of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]-dependent [wiki|transcription]
product
modulator of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]-containing [wiki|RNA polymerase]
essential
no
synonyms
ylyA, ylmK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1734

This gene is a member of the following regulons

Gene
Coordinates
1,616,267  1,616,641
Phenotypes of a mutant
defective in spore [wiki|germination] efficiency [Pubmed|23123912]
The protein
Structure
[AF|Q45478]
Paralogous protein(s)
[protein|633F6F54AFA144D4F65EA36B8D5670D3FC25EDA6|yocK], [protein|70A5A147B908001878161D45AAEB08132AD0DB8C|yteA]
[wiki|Localization]
located at the cell periphery [Pubmed|18720851]
Expression and Regulation
Operons
genes
[gene|8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5|ylyA]
description
[Pubmed|22383849]
regulation
expressed late during [wiki|sporulation] in the forespore ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|23123912]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|23123912], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|23123912], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5|ylyA]

2022-12-19 12:30:06

ghost

20

dd5e0257852fba7371f2bfa646b9841cb9c4140a

A473B22F443A9021F67DE4D8EE60259193FE2741

Biological materials
Mutant
MGNA-B126 (ylyA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1125 NBRP B. subtilis, Japan]
1A816 ( ''ylyA''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A816&Search=1A816 BGSC]
BKE15440 ([gene|8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5|ylyA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTTCACAACTCCTGCT,  downstream forward: _UP4_TAACAGTGTCTGTCCGGTTA
BKK15440 ([gene|8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5|ylyA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTTCACAACTCCTGCT,  downstream forward: _UP4_TAACAGTGTCTGTCCGGTTA
References
23123912,18720851,22383849,23678950

8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5

Page visits: 2933

Time of last update: 2023-02-07 19:06:56

Author of last update: Jstuelk