levF

levF
168

fructose-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIC of the [category|SW.1.2.2|PTS]

locus
BSU_27050
Molecular weight
27.87 kDa
pI
4.39
Protein length
Gene length
function
fructose uptake and phosphorylation
product
fructose-specific [category|SW.1.2.2|PTS], EIIC component
essential
no
synonyms
levF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3715

This gene is a member of the following regulons

Gene
Coordinates
2,761,081  2,761,890
The protein
Protein family
[category|SW.1.2.2|PTS] permease, mannose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIC domain] type-4 (aa 1-234) (according to UniProt)
Structure
[AF|P26381]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]
description
[Pubmed|2117666]
regulation
induced in the presence of fructose ([protein|search|LevR]) [Pubmed|1900939]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7592486], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR]: activation, [Pubmed|1900939], in [regulon|protein:1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR regulon]
sigma factors
[protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]: sigma factor, [Pubmed|1924373], in [regulon|protein:1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL regulon]
Open in new tab

[gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]→[gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]

2022-11-23 22:04:43

ghost

24

d0f853318c4c7bee208c4a44dec93cde9661ecc4

0E14E80CBB0982955C34B99D35F549A378E3F088

Biological materials
Mutant
BKE27050 ([gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE27050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAGACATATTCTCATCCC,  downstream forward: _UP4_TAAACGATGAGGGGGAAGAA
BKK27050 ([gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK27050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAGACATATTCTCATCCC,  downstream forward: _UP4_TAAACGATGAGGGGGAAGAA
References
10627040,2117666,1924373,7592486,1900939

8ABA3735067C7AA433E09F219EE7239196377A95

Page visits: 3469

Time of last update: 2022-11-27 03:33:13

Author of last update: Melvin.boenninger