yfiG

yfiG
168

D-chiro-inositol transport protein

locus
BSU_08260
Molecular weight
52.59 kDa
pI
10.12
Protein length
Gene length
function
uptake of D-chiro-inositol
product
D-chiro-inositol transport protein
essential
no
synonyms
yfiG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
900,080  901,528
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
Structure
[PDB|4LDS] (from Staphylococcus epidermidis, 37% identity) [pubmed|24127585]
[AF|P54723]
Paralogous protein(s)
[protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|yncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|araE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]-[gene|8DA8F976B846665FA9E6BD0FF86FE1F58CCFD260|yfiH]-[gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]
description
[pubmed|22383849]
Open in new tab

[gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]→[gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]

2022-12-04 08:44:20

Jstuelk

31

b865cc31d96c5fe3ad5670cf06670a32d1d4026d

70B62AA6E1970EF89FAD5C55C8777685590D5044

Biological materials
Mutant
MGNA-C297 (yfiG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2295 NBRP B. subtilis, Japan]
BKE08260 ([gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGGCTTTCTTCCCCTTCT,  downstream forward: _UP4_TAACCTGAGATACCAGGAGG
BKK08260 ([gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGGCTTTCTTCCCCTTCT,  downstream forward: _UP4_TAACCTGAGATACCAGGAGG
References
Research papers
24127585

8B0701B5694ABA8142476CB896E590FE1981D7DB

Page visits: 1359

Time of last update: 2022-11-27 05:40:00

Author of last update: Melvin.boenninger