SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


D-chiro-inositol transport protein

Molecular weight
52.59 kDa
Protein length
Gene length
uptake of D-chiro-inositol
D-chiro-inositol transport protein

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

900,080  901,528
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
[PDB|4LDS] (from Staphylococcus epidermidis, 37% identity) [pubmed|24127585]
Paralogous protein(s)
[protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|yncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|araE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]
cell membrane (according to UniProt)
Expression and Regulation
Open in new tab


2021-10-12 20:42:22





Biological materials
MGNA-C297 (yfiG::erm), available at the [ NBRP B. subtilis, Japan]
BKE08260 ([gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGGCTTTCTTCCCCTTCT,  downstream forward: _UP4_TAACCTGAGATACCAGGAGG
BKK08260 ([gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGGCTTTCTTCCCCTTCT,  downstream forward: _UP4_TAACCTGAGATACCAGGAGG
Research papers


Page visits: 1180

Time of last update: 2022-01-19 08:39:59

Author of last update: Melvin.boenninger