splA

splA
168

transcriptional repressor of the spore photoproduct lyase splA-splB operon

locus
BSU_13920
Molecular weight
9.08 kDa
pI
4.42
Protein length
Gene length
function
regulation of the splA-splB operon
product
transcriptional regulator
essential
no
synonyms
splA, ykxI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,461,453  1,461,692
The protein
Structure
[AF|P37955]
Expression and Regulation
Operons
genes
[gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]-[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]
description
[Pubmed|8021181]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
regulatory mechanism
[protein|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]: negative autoregulation, in [regulon|protein:8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,8021181], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]→[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]

2022-12-13 12:54:09

ghost

17

05c0d6ddc5311aaa4612ef8b425cad6eec3b8cd4

ADCA4EE37BF8E4BFD653F8A03FBE5F3F554C5DF8

Biological materials
Mutant
BKE13920 ([gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTATCCCTCCTAGCCA,  downstream forward: _UP4_TAACAAGGAAATCATTACAA
BKK13920 ([gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTATCCCTCCTAGCCA,  downstream forward: _UP4_TAACAAGGAAATCATTACAA
References
Reviews
23164663
Original Publications
15699190,8021181,22761404,10629212
Structure of the spore photoproduct lesion in DNA
24598744

8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018

Page visits: 1262

Time of last update: 2023-02-04 22:03:24

Author of last update: Bzhu