rapE

rapE
168

response regulator aspartate phosphatase, dephosphorylates Spo0F-P, control of the phosphorelay

locus
BSU_25830
Molecular weight
44.40 kDa
pI
7.31
Protein length
Gene length
function
control of sporulation initiation
product
response regulator aspartate phosphatase
essential
no
synonyms
rapE, yqcH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,659,213  2,660,340
The protein
Protein family
[wiki|RAP family] (according to UniProt)
[wiki|Domains]
six [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF], 38% identity) [pubmed|23526880]
[AF|P45943]
Expression and Regulation
Operons
genes
[gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]-[gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]
description
[Pubmed|11466295,10629174]
regulation
repressed by glucose (10-fold) ([protein|search|CcpA]) [Pubmed|12850135]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|23569278,12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
Open in new tab

[gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]→[gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]

2022-11-28 22:47:56

ghost

31

f608cde1e59e85e18714813f7f7758010526367d

952AED7D01C486511F8A9AB8B0D3EDEAA707B8AA

Biological materials
Mutant
BKE25830 ([gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGATATTCACCCTTCCCT,  downstream forward: _UP4_CAAATATCGAAAGGGGAATG
BKK25830 ([gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGATATTCACCCTTCCCT,  downstream forward: _UP4_CAAATATCGAAAGGGGAATG
References
12618455,11466295,10629174,23569278,25225273,23526880

8B8646DF7F437D8DB299A77BA937DC6FC082102F

Page visits: 2608

Time of last update: 2022-12-08 09:30:17

Author of last update: Melvin.boenninger