brnQ

brnQ
168

branched-chain amino acid transporter

locus
BSU_26690
Molecular weight
46.84 kDa
pI
9.78
Protein length
Gene length
function
uptake of valine and isoleucine
product
branched-chain amino acid transporter
essential
no
synonyms
brnQ, yrdJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1114

This gene is a member of the following regulons

Gene
Coordinates
2,727,160  2,728,482
Phenotypes of a mutant
no phenotype for the single mutant, the triple [gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB] mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
The protein
Catalyzed reaction/ biological activity
high affinity uptake of isoleucine and valine [Pubmed|25645558]
Protein family
branched chain amino acid transporter family (together with [protein|75A874F0C344E8404BE39C32EFF59CE562193640|braB]) (according to UniProt)
Structure
[AF|P94499]
Paralogous protein(s)
[protein|75A874F0C344E8404BE39C32EFF59CE562193640|braB]
Expression and Regulation
Operons
genes
[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]-[gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]-[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]
description
[Pubmed|36377869,9287000]
regulation
repressed by [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB] [Pubmed|36377869,9287000]
regulatory mechanism
[protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]: repression, [Pubmed|36377869,9287000], in [regulon|protein:D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB regulon]
Open in new tab

[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]→[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]

2022-12-01 22:01:55

Jstuelk

29

CE7A54721725B20F53C4F64C9153F7B05416307A

77D75B92D3B22CF1350DD9E108E868095EE55DEB

Biological materials
Mutant
BKE26690 ([gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATATATCCTCCGATTA,  downstream forward: _UP4_ATTCCAGCTATTGCAGGAGG
BKK26690 ([gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATATATCCTCCGATTA,  downstream forward: _UP4_ATTCCAGCTATTGCAGGAGG
References
9287000,25645558

8BB8BDA602CC26B0A9E8C22666F0EC539306CF39

Page visits: 1781

Time of last update: 2022-12-06 02:19:32

Author of last update: Jstuelk