SubtiWiki SubtiWiki
panC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

panC
168

pantothenate synthase

locus
BSU_22420
Molecular weight
31.81 kDa
pI
4.63
Protein length
Gene length
function
biosynthesis of coenzyme A
product
pantothenate synthase
essential
no
ec
6.3.2.1
synonyms
panC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0414

This gene is a member of the following regulons

Gene
Coordinates
2,352,977  2,353,837
The protein
Catalyzed reaction/ biological activity
(R)-pantoate + ATP + β-alanine --> (R)-pantothenate + AMP + diphosphate + H+ (according to UniProt)
Protein family
pantothenate synthetase family (single member, according to UniProt)
Structure
[PDB|2EJC] (from ''Thermotoga maritima'', 50% identity, 66% similarity)
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Biological materials
Mutant
BKE22420 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAATATCAGTAATCTGTC,  downstream forward: _UP4_ATTCGAGAAATGGAGAGAAT
BKK22420 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAATATCAGTAATCTGTC,  downstream forward: _UP4_ATTCGAGAAATGGAGAGAAT

8BE55434677F4EC3D6766C7163496CB1B659F57F

Page visits: 1772

Time of last update: 2022-01-18 11:10:21

Author of last update: Melvin.boenninger