SubtiWiki SubtiWiki
tapA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

tapA
168

[protein|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA] anchoring/assembly protein

locus
BSU_24640
Molecular weight
28.92 kDa
pI
6.68
Protein length
Gene length
function
[wiki|biofilm formation]
product
[protein|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA] anchoring/assembly protein
essential
no
synonyms
tapA, yqhD, yqxM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,554,486  2,555,247
Phenotypes of a mutant
no biofilm formation [Pubmed|24488317]
The protein
Structure
[PDB|6HQC]
[wiki|Localization]
attached to the cell surface (on the outside of the cell), associated with peptidoglycan  [Pubmed|21477127]
secretion requires [protein|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW] [Pubmed|10559173]
Expression and Regulation
Operons
genes
[gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]
description
[Pubmed|16430695]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|10464223,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|16430695], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: activation, [Pubmed|24196425], in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16430695], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] [PubMed|15661000,19788541] or by SlrR [PubMed|20351052]
expression of the operon is localized to a ring near the periphery of the biofilm [pubmed|29590605]
Open in new tab

[gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]→[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]

2022-01-03 14:23:47

Jstuelk

23

5d4b2839ae781570552ba6a28b48e7489d628dd2

25F0FAE210D5101B1935E4625742633C173FC509

Biological materials
Mutant
MGNA-C429 (yqhD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2427 NBRP B. subtilis, Japan]
BKE24640 ([gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTTACCTCCTGTAAA,  downstream forward: _UP4_AGCAATGAAGCTGATCAGTA
BKK24640 ([gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTTACCTCCTGTAAA,  downstream forward: _UP4_AGCAATGAAGCTGATCAGTA
lacZ fusion
pGP1926 (in [wiki|pAC6]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
21488983,25907113,33824496
Original Publications
18430133,18047568,18647168,20351052,16430695,10464223,17720793,19605685,20431016,10559173,21477127,21856853,21815947,23646920,24488317,25894589,26819068,29590605,30371005,32491277,32779018

8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3

Page visits: 5049

Time of last update: 2022-01-18 23:37:57

Author of last update: Jstuelk