sacA

sacA
168

phosphosucrase

locus
BSU_38040
Molecular weight
54.72 kDa
pI
5.34
Protein length
Gene length
function
utilization of sucrose
product
phosphosucrase
essential
no
ec
3.2.1.26
synonyms
sacA, ipa-50d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1621

This gene is a member of the following regulons

Gene
Coordinates
3,902,210 → 3,903,649
The protein
Catalyzed reaction/ biological activity
Hydrolysis of terminal non-reducing beta-D-fructofuranoside residues in beta-D-fructofuranosides (according to UniProt)
Protein family
glycosyl hydrolase 32 family (with [protein|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB] and [protein|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC], according to UniProt)
Structure
[PDB|3PIG] (beta-fructofuranosidase from Bifidobacterium longum, 29% identity) [pubmed|21418142]
[AF|P07819]
Expression and Regulation
Operons
genes
[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]
description
[Pubmed|3100393]
regulation
induced by sucrose ([protein|search|SacT]) [Pubmed|2163394]
regulatory mechanism
[protein|6796E1C147AA21E919A42A953884DC24E182F430|sacT]: antitermination, via binding to a [wiki|RNA switch], in [regulon|protein:6796E1C147AA21E919A42A953884DC24E182F430|sacT regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8702561], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]→[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]

2022-11-21 19:54:23

ghost

28

84ac6df24eedff839607263961d011c324b7f03e

98AC56561C7DAA3F5751178FDFB48FF02310E968

Biological materials
Mutant
1A810 ( ''sacA''::''cat''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A810&Search=1A810 BGSC]
1A811 ( ''sacA''::''kan''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A811&Search=1A811 BGSC]
BKE38040 (Δ[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTTTCCTCTCCTC,  downstream forward: _UP4_TAGAAAATCCTTCTATTTTC
BKK38040 (Δ[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTTTCCTCTCCTC,  downstream forward: _UP4_TAGAAAATCCTTCTATTTTC
References
3100393,8702561,2163394,21418142

8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88

Page visits: 4466

Time of last update: 2022-11-29 17:09:48

Author of last update: Melvin.boenninger