clpE

clpE
168

AAA unfoldase, ATPase subunit of the [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] protease (class III stress gene)

locus
BSU_13700
Molecular weight
77.72 kDa
pI
5.14
Protein length
Gene length
function
protein degradation
product
AAA unfoldase, ATPase subunit of the [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] protease
essential
no
synonyms
clpE, ykvH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0542

This gene is a member of the following regulons

Gene
Coordinates
1,435,628  1,437,727
The protein
Catalyzed reaction/ biological activity
ATPase/chaperone
Protein family
ClpA/ClpB family (with [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC], according to UniProt)
[wiki|Domains]
AAA-ATPase [http://pfam.sanger.ac.uk/family?acc=PF07724 PFAM]
[wiki|UVR domain] (aa 325-360) (according to UniProt)
Structure
[PDB|6EM8] ([protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] from Staphylococcus aureus, 54% identity) [pubmed|29165246]
[AF|O31673]
Paralogous protein(s)
[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]
[wiki|Localization]
localization in cytoplasmic polar clusters, excluded from the nucleoid, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] [http://www.ncbi.nlm.nih.gov/pubmed/18786145 Pubmed]
forms foci coincident with nucleoid edges, usually near cell poles [Pubmed|18689473]
Expression and Regulation
Operons
genes
[gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]
description
[Pubmed|10320580]
regulation
induced by heat ([protein|search|CtsR]) [Pubmed|10320580,9987115]
regulatory mechanism
[protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]: repression, [Pubmed|10320580,9987115,11179229,16163393,17380125], in [regulon|protein:908DB17A39D518E84977250C55825E77FA02E391|ctsR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10320580], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]

2022-12-29 13:00:16

ghost

32

70ee23115086270596dd5085fcef39e59d159f88

CD123E8BF4C8D5620B75122505863C86AD11D257

Biological materials
Mutant
''clpE::spec'' available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
BKE13700 ([gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAAAACCTCCTTA,  downstream forward: _UP4_TAACAATCAGCGGTTTCCTT
BKK13700 ([gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAAAACCTCCTTA,  downstream forward: _UP4_TAACAATCAGCGGTTTCCTT
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1799 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
Antibody
available in [wiki|Ulf Gerth]'s and [wiki|Jörg Stülke]'s labs
GFP fusion
C-terminal YFP and CFP fusions (single copy) available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
References
Reviews
26639779,28748186,34410368,34438398
Original Publications
17302811,29165246
Labs working on this gene/protein
[wiki|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]

8C5B14FE5E03427F9A598C75D4081FA0D6696299

Page visits: 3319

Time of last update: 2023-02-02 03:48:17

Author of last update: Jstuelk