SubtiWiki SubtiWiki
yxzE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yxzE
168

unknown

locus
BSU_38790
Molecular weight
6.70 kDa
pI
5.1
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yxzE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,982,973  3,983,173
Expression and Regulation
Operons
genes
[gene|8C8DFC3CE03F8F3EE38376D42DD0D29ACE105A06|yxzE]
description
[Pubmed|9987136]
regulation
repressed during logrithmic growth ([protein|search|AbrB]) [Pubmed|12076816]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12076816], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|8C8DFC3CE03F8F3EE38376D42DD0D29ACE105A06|yxzE]

2021-10-17 23:36:17

ghost

2

71d0df0441a6a24394019d0f496ff555017e70c3

CEB01AC6C73D7D01584545BF740315A48BA01A9E

Biological materials
Mutant
BKE38790 ([gene|8C8DFC3CE03F8F3EE38376D42DD0D29ACE105A06|yxzE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTCGCGTCACTCCCTTT,  downstream forward: _UP4_GGCGGCGATTAAACGCCGCC
BKK38790 ([gene|8C8DFC3CE03F8F3EE38376D42DD0D29ACE105A06|yxzE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTCGCGTCACTCCCTTT,  downstream forward: _UP4_GGCGGCGATTAAACGCCGCC
References
12884008,9987136,12076816

8C8DFC3CE03F8F3EE38376D42DD0D29ACE105A06

Page visits: 761

Time of last update: 2022-01-18 09:21:37

Author of last update: Bzhu