pgpH

pgpH
168

c-di-AMP specific phosphodiesterase

locus
BSU_25330
Molecular weight
78.98 kDa
pI
7.7
Protein length
Gene length
function
control of c-di-AMP homeostasis
product
c-di-AMP specific phosphodiesterase
essential
no
synonyms
pgpH, yqfF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1480

This gene is a member of the following regulons

Gene
Coordinates
2,612,282  2,614,417
Phenotypes of a mutant
a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant acquires suppressor mutations in ''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]'' [Pubmed|26240071]
a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant is defective in [wiki|biofilm formation] [Pubmed|27252699]
altered morphology on MSgg medium [pubmed|29588402]
suppresses the growth defect of [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutants on gluconeogenic substrates [Pubmed|16272399]
significantly delayed osmoadaptation to high NaCl [pubmed|35164567]
The protein
Catalyzed reaction/ biological activity
hydrolysis of c-di-AMP to 5'-pApA [Pubmed|25583510]
3',3'-c-di-AMP + H2O --> 5'-O-phosphonoadenylyl-(3'→5')-adenosine + H+ (according to UniProt)
Protein family
PgpH phosphodiesterase family (single member, according to UniProt)
[wiki|Domains]
[wiki|HD domain] (aa 501-643) (according to UniProt)
[wiki|Cofactors]
Mn2+ [Pubmed|25583510]
Structure
[PDB|4S1B] (the HD domain of the protein from ''Listeria monocytogenes'' in complex with c-di-AMP, 58% identity, 85% similarity) [Pubmed|25583510]
[AF|P46344]
Effectors of protein activity
ppGpp acts as allosteric inhibitor of phosphodiesterase activity (in ''Listeria monocytogenes'') [Pubmed|25583510]
[wiki|Localization]
cell membrane [Pubmed|25583510]
Biological materials
Mutant
MGNA-C432 (yqfF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2430 NBRP B. subtilis, Japan]
SM-GN1 (''pgpH-spc''), available in [wiki|Anne Galinier]'s and [wiki|Boris Görke]'s labs [pubmed|16272399]
BKE25330 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in the BGSC and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
GP2033 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''tet'', available in [wiki|Jörg Stülke]'s lab)
GP2034 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in [wiki|Jörg Stülke]'s lab) [Pubmed|26240071]
GP2040 (''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]''::''spc'' ''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in [wiki|Jörg Stülke]'s lab) [Pubmed|26240071]
GP2049 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''cat'' without terminator, available in [wiki|Jörg Stülke]'s lab)
BKE25330 ([gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAGAACCTCCTCTTGAA,  downstream forward: _UP4_GAGGCTACTAAGAAGGTGAA
BKK25330 ([gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAGAACCTCCTCTTGAA,  downstream forward: _UP4_GAGGCTACTAAGAAGGTGAA
lacZ fusion
pGP190 (in [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
References
Reviews
25637595,25869574,26773214,30224435,32472931,32603625, 32496757
Original Publications
21630458,25583510,26240071,27252699,29588402,16272399,35164567

8D0885839CD60C05FB806BBF08AFA05225E83B12

Page visits: 2667

Time of last update: 2022-12-02 10:23:27

Author of last update: Jstuelk