yhcY

yhcY
168

two-component sensor kinase

locus
BSU_09320
Molecular weight
41.83 kDa
pI
6.64
Protein length
Gene length
function
unknown
product
two-component sensor kinase
essential
no
synonyms
yhcY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4585

This gene is a member of the following regulons

Gene
Coordinates
1,008,668  1,009,807
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ] in a Asp residue
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
[wiki|Histidine kinase domain] (aa 185-373) (according to UniProt)
Structure
[AF|O07527]
Modification
autophosphorylation on a His residue
[wiki|Localization]
cytoplasm (Homogeneous) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]-[gene|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ]-[gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]
description
[Pubmed|16816187]
regulatory mechanism
[protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]: activation, [Pubmed|16816187], in [regulon|protein:49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16816187], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]→[gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]

2022-11-29 22:07:30

ghost

19

8cc56cf62393d735d27584617b4d54806f9369b1

5E51555D7512C898216E1762D43B864CFD152408

Biological materials
Mutant
MGNA-A729 (yhcY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/729 NBRP B. subtilis, Japan]
BKE09320 ([gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTTCTCACTCCGGCAT,  downstream forward: _UP4_AAAAGCCGAAAAGGAGGGGC
BKK09320 ([gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTTCTCACTCCGGCAT,  downstream forward: _UP4_AAAAGCCGAAAAGGAGGGGC
References
10094672,20639339,16816187,16479537,29785949

8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD

Page visits: 1937

Time of last update: 2022-12-02 01:42:52

Author of last update: Melvin.boenninger