yfiH

yfiH
168

unknown

locus
BSU_08270
Molecular weight
34.61 kDa
pI
5.21
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfiH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1082

This gene is a member of the following regulons

Gene
Coordinates
901,555  902,496
The protein
Structure
[PDB|2ZDS] (from Streptomyces coelicolor, 27% identity) [pubmed|18782066]
[AF|P54724]
Expression and Regulation
Operons
genes
[gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]-[gene|8DA8F976B846665FA9E6BD0FF86FE1F58CCFD260|yfiH]-[gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]
description
[pubmed|22383849]
Open in new tab

[gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]→[gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]

2022-12-04 08:44:20

Jstuelk

31

b865cc31d96c5fe3ad5670cf06670a32d1d4026d

70B62AA6E1970EF89FAD5C55C8777685590D5044

Biological materials
Mutant
MGNA-C298 (yfiH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2296 NBRP B. subtilis, Japan]
BKE08270 ([gene|8DA8F976B846665FA9E6BD0FF86FE1F58CCFD260|yfiH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGATAGATTCCTCCTGG,  downstream forward: _UP4_ACCATCAGCCAATAGGAGGT
BKK08270 ([gene|8DA8F976B846665FA9E6BD0FF86FE1F58CCFD260|yfiH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGATAGATTCCTCCTGG,  downstream forward: _UP4_ACCATCAGCCAATAGGAGGT
References
Research papers
18782066

8DA8F976B846665FA9E6BD0FF86FE1F58CCFD260

Page visits: 881

Time of last update: 2022-12-02 21:55:06

Author of last update: Jstuelk