SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!



Molecular weight
34.61 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1082

This gene is a member of the following regulons

901,555  902,496
The protein
[PDB|2ZDS] (from Streptomyces coelicolor, 27% identity) [pubmed|18782066]
Expression and Regulation
Open in new tab


2021-10-12 20:42:22





Biological materials
MGNA-C298 (yfiH::erm), available at the [ NBRP B. subtilis, Japan]
BKE08270 ([gene|8DA8F976B846665FA9E6BD0FF86FE1F58CCFD260|yfiH]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGATAGATTCCTCCTGG,  downstream forward: _UP4_ACCATCAGCCAATAGGAGGT
BKK08270 ([gene|8DA8F976B846665FA9E6BD0FF86FE1F58CCFD260|yfiH]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGATAGATTCCTCCTGG,  downstream forward: _UP4_ACCATCAGCCAATAGGAGGT
Research papers


Page visits: 722

Time of last update: 2022-01-18 20:33:44

Author of last update: Jstuelk