SubtiWiki SubtiWiki
tkmA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

tkmA
168

transmembrane modulator of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA] activity, activates [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA] autophosphorylation and substrate phosphorylation

locus
BSU_36260
Molecular weight
26.49 kDa
pI
4.61
Protein length
Gene length
function
control of protein tyrosine phosphorylation
product
modulator of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA] activity
essential
no
synonyms
tkmA, ywqC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3944

This gene is a member of the following regulons

Gene
Coordinates
3,732,525  3,733,271
Phenotypes of a mutant
the mutant exhibits a defect in [wiki|biofilm formation], pronounced on LBGM medium, weak of MSgg medium [Pubmed|26283769,20815827], this can be compensated for by overexpression of ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]'' or by mutations that reduce the expression of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] [Pubmed|26283769]
The protein
Catalyzed reaction/ biological activity
transmembrane activation of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA] protein tyrosine kinase activity
Protein family
CapA family (with [protein|A696434A086A428D411CAF45B37CD8F82AC2503F|capA] and [protein|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA], according to UniProt)
CpsC/CapA family (with [protein|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA], according to UniProt)
Paralogous protein(s)
[protein|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]-[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]-[gene|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd]
description
[Pubmed|20815827,12970183]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|26283769], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|26283769], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20815827], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]→[gene|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd]

2021-12-07 02:41:32

ghost

11

c2e9da4a42fde0cc0e5b798663a12ae407bf7d28

23621A956181A8BE93792267290B609197EA8EF4

Biological materials
Mutant
MGNA-A034 (ywqC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/34 NBRP B. subtilis, Japan]
GP1566 (spc) [Pubmed|24493247], available in [wiki|Jörg Stülke]'s lab
GP1567 ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]''::aphA3 ''[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]''::spc [Pubmed|24493247], available in [wiki|Jörg Stülke]'s lab
BKE36260 ([gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATACCTCCAAATCTCT,  downstream forward: _UP4_TCTGAAAAAACGGGGAGTGG
BKK36260 ([gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATACCTCCAAATCTCT,  downstream forward: _UP4_TCTGAAAAAACGGGGAGTGG
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1620 ''tkmA''-FLAG 3x spc (based on [wiki|pGP1331]) available in [wiki|Jörg Stülke]'s lab
References
12970183,20815827,20817675,23939619,24493247,26283769,27725816

8DCA50478136628DD9E5D01E89609A686EED9F57

Page visits: 2752

Time of last update: 2022-01-18 05:55:54

Author of last update: Melvin.boenninger