ahpF

ahpF
168

alkyl hydroperoxide reductase (large subunit) / NADH dehydrogenase

locus
BSU_40100
Molecular weight
54.71 kDa
pI
4.7
Protein length
Gene length
function
resistance against peroxide stress
product
alkyl hydroperoxide reductase (large subunit) / NADH dehydrogenase
essential
no
ec
1.6.99.3
synonyms
ahpF, ndh

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3634

This gene is a member of the following regulons

Gene
Coordinates
4,119,527  4,121,056
The protein
Catalyzed reaction/ biological activity
A + H+ + NADH --> AH2 + NAD+ (according to UniProt)
Protein family
class-II pyridine nucleotide-disulfide oxidoreductase family (with [protein|1BC439BBCD5FE19D5780519D7E4317C2EFF0D21B|trxB], according to UniProt)
[wiki|Domains]
Thioredoxin-like fold domain (aa 108-210) (according to InterPro)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|1HYU] (from ''Salmonella typhimurium'', 52% identity, 69% similarity) [Pubmed|11300769]
[AF|P42974]
Modification
phosphorylation on (Ser-48 OR Ser-49) [Pubmed|17218307]
phosphorylated on Arg-457 [Pubmed|22517742]
[wiki|Localization]
cell membrane (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]-[gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]
description
[Pubmed|8932314]
regulation
induced by H2O2 ([protein|search|PerR]) [Pubmed|11532148]
regulatory mechanism
[protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]: repression, [Pubmed|11532148], in [regulon|protein:00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8932314], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]→[gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]

2022-05-21 09:31:51

ghost

28

faf2593fbfc50585279e38e62b17a9a5b60cff9f

9798B313F3B383CB7131D3E1F8AD0DA2D1B1888C

Biological materials
Mutant
GP1730 [gene|search|ahpCF]::mls trpC2 available in [wiki|Jörg Stülke]'s lab
BKE40100 ([gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCAAGTACCAATTGAATGC,  downstream forward: _UP4_TAATATAAGAAATCCGCTAT
BKK40100 ([gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCAAGTACCAATTGAATGC,  downstream forward: _UP4_TAATATAAGAAATCCGCTAT
References
11532148,16232966,8932314,8932315,11532148,17218307,22517742,15581580

8F23B575BC32EA63267C4321DD8E4BD546B11AF1

Page visits: 2749

Time of last update: 2022-06-25 20:37:45

Author of last update: Melvin.boenninger