nagA

nagA
168

N-acetylglucosamine-6-phosphate deacetylase

locus
BSU_35010
Molecular weight
42.46 kDa
pI
5.28
Protein length
Gene length
function
N-acetylglucosamine utilization
product
N-acetylglucosamine-6-phosphate deacetylase
essential
no
ec
3.5.1.25
synonyms
nagA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1820

This gene is a member of the following regulons

Gene
Coordinates
3,595,356  3,596,546
Phenotypes of a mutant
no growth on N-acetylglucosamine [Pubmed|23667565]
The protein
Catalyzed reaction/ biological activity
H2O + N-acetyl-D-glucosamine 6-phosphate --> acetate + D-glucosamine 6-phosphate (according to UniProt)
Protein family
[wiki|Metallo-dependent hydrolases superfamily] (according to UniProt)
Structure
[PDB|2VHL] [Pubmed|14557261]
[AF|O34450]
Kinetic information
K(M): 1.4 mM [Pubmed|14343123]
Expression and Regulation
Operons
genes
[gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]-[gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]-[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]
description
[Pubmed|21602348]
regulation
induced in the presence of N-acetylglucosamine ([protein|search|NagR]) [Pubmed|24673833,21602348,14343123]
regulatory mechanism
[protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]: repression, [Pubmed|24673833,21602348], in [regulon|protein:6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23667565], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]→[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]

2022-11-26 05:24:36

ghost

25

dfb9f60c6cb4712882f6e111396691335972d607

2CE10C0E65E696F5F9B1AAC17ED9D19E163A6ECF

Biological materials
Mutant
MGNA-A337 (nagA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/337 NBRP B. subtilis, Japan]
BKE35010 ([gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGATGATCCGCCTTTCT,  downstream forward: _UP4_ATATCCAAGGAGGCTGACCA
BKK35010 ([gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGATGATCCGCCTTTCT,  downstream forward: _UP4_ATATCCAAGGAGGCTGACCA
References
Reviews
26159076
Original Publications
10627040,14343123,12850135,6174502,14557261,23667565,21602348,24673833,23876412,25564531

8F4D075C9B9EF995E361F9BA5E8B52F42059C422

Page visits: 1835

Time of last update: 2022-11-26 20:25:43

Author of last update: Melvin.boenninger