yhdR

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yhdR
168

similar to aspartate aminotransferase

locus
BSU_09570
Molecular weight
43.73 kDa
pI
5.01
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
2.6.1.1
synonyms
yhdR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0436

This gene is a member of the following regulons

Gene
Coordinates
1,034,046  1,035,227
The protein
Catalyzed reaction/ biological activity
2-oxoglutarate + L-aspartate --> L-glutamate + oxaloacetate (according to UniProt)
Protein family
[wiki|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
[wiki|Cofactors]
PLP
Structure
[PDB|3ELE] (from Eubacterium rectale, 34% identity)
[AF|O07587]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Additional information
The gene is annotated in KEGG as aspartate aminotransferase EC 2.6.1.1. In MetaCyc the protein is marked as similar to aspartate aminotransferase. No EC annotation is available in Swiss-Prot. No literature/experimental evidence supporting the annotation is availablavailable.  [Pubmed|19935659]
Expression and Regulation
Operons
genes
[gene|8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE|yhdR]
description
[Pubmed|22383849]
Open in new tab

[gene|8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE|yhdR]

2022-04-08 08:07:37

Jstuelk

3

cf8909e14c6720936511d3a9f5e5af9511f05907

1C3FFFBC5A9FD640806CC987C76AF77BA9E95997

Biological materials
Mutant
MGNA-B485 (yhdR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1484 NBRP B. subtilis, Japan]
BKE09570 ([gene|8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE|yhdR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCCCTTCCGCATAT,  downstream forward: _UP4_TAAGAAGGCAAAGAAAAGAA
BKK09570 ([gene|8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE|yhdR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCCCTTCCGCATAT,  downstream forward: _UP4_TAAGAAGGCAAAGAAAAGAA

8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE

Page visits: 1065

Time of last update: 2022-05-17 08:46:00

Author of last update: Melvin.boenninger