ddcA

ddcA
168

DNA damage checkpoint antagonist, prevents [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA]-dependent cell elongation

locus
BSU_28240
Molecular weight
35.70 kDa
pI
4.39
Protein length
Gene length
function
control of [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA] activity
product
DNA damage checkpoint antagonist
essential
no
synonyms
ddcA, ysoA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,887,817  2,888,821
Phenotypes of a mutant
sensitive to DNA damage exposure, this can be rescued by deletion of [gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA] [pubmed|30315724]
The protein
[wiki|Domains]
three [wiki|TPR repeat|tetratrichopeptide repeats] [pubmed|30315724]
Structure
[AF|P94569]
[wiki|Localization]
cytosol [pubmed|30315724]
Biological materials
Mutant
MGNA-A995 (ysoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/995 NBRP B. subtilis, Japan]
BKE28240 ([gene|8F8CFC1F80227BA791AAAB884E6485C27A78C31A|ddcA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCTATATTCCTTTCAG,  downstream forward: _UP4_TAAATCGCGCCATATAGTTG
BKK28240 ([gene|8F8CFC1F80227BA791AAAB884E6485C27A78C31A|ddcA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCTATATTCCTTTCAG,  downstream forward: _UP4_TAAATCGCGCCATATAGTTG
References
Research papers
30315724

8F8CFC1F80227BA791AAAB884E6485C27A78C31A

Page visits: 1014

Time of last update: 2023-02-08 00:35:42

Author of last update: Jstuelk