SubtiWiki SubtiWiki
yesV

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yesV
168

unknown

locus
BSU_07040
Molecular weight
23.02 kDa
pI
8.99
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yesV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5578

This gene is a member of the following regulons

Gene
Coordinates
769,487  770,113
Expression and Regulation
Operons
genes
[gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]-[gene|2DC415DCC2ECC3B46526108638DDB46C28832041|rhiF]-[gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]-[gene|8EED04FCE6E2900B729178209FB281F5463B2540|rhiN]-[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]-[gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]-[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]-[gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]-[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]-[gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]-[gene|578B79EB64B804FCAACA73AB22458481371A815C|yesY]-[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]
description
[Pubmed|22383849]
regulation
induced by pectin ([protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]) [Pubmed|19651770]
regulatory mechanism
[protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]: activation, [Pubmed|19651770], in [regulon|protein:BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR regulon]
Open in new tab

[gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]→[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]

2022-01-06 06:31:36

Jstuelk

10

D891C8F38E150B653BA655BA6352352D86D18BAE

A10D4124F5AF6831808648D33C98AF061D3703AA

Biological materials
Mutant
MGNA-B453 (yesV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1452 NBRP B. subtilis, Japan]
BKE07040 ([gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGCGCATCCGTTACAGTCG,  downstream forward: _UP4_TAACAAAAAAATGACAAATA
BKK07040 ([gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGCGCATCCGTTACAGTCG,  downstream forward: _UP4_TAACAAAAAAATGACAAATA
References
19651770,17449691

8FE909876A7A21B436CA0CFB90ED190BAD17C8E1

Page visits: 1266

Time of last update: 2022-01-15 06:15:17

Author of last update: Bzhu