yesV

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yesV
168

unknown

locus
BSU_07040
Molecular weight
23.02 kDa
pI
8.99
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yesV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5578

This gene is a member of the following regulons

Gene
Coordinates
769,487  770,113
The protein
Structure
[AF|O31525]
Expression and Regulation
Operons
genes
[gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]-[gene|2DC415DCC2ECC3B46526108638DDB46C28832041|rhiF]-[gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]-[gene|8EED04FCE6E2900B729178209FB281F5463B2540|rhiN]-[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]-[gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]-[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]-[gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]-[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]-[gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]-[gene|578B79EB64B804FCAACA73AB22458481371A815C|yesY]-[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]
description
[Pubmed|22383849]
regulation
induced by pectin ([protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]) [Pubmed|19651770]
regulatory mechanism
[protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]: activation, [Pubmed|19651770], in [regulon|protein:BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR regulon]
Open in new tab

[gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]→[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]

2022-05-08 03:48:21

Jstuelk

23

D891C8F38E150B653BA655BA6352352D86D18BAE

A10D4124F5AF6831808648D33C98AF061D3703AA

Biological materials
Mutant
MGNA-B453 (yesV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1452 NBRP B. subtilis, Japan]
BKE07040 ([gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGCGCATCCGTTACAGTCG,  downstream forward: _UP4_TAACAAAAAAATGACAAATA
BKK07040 ([gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGCGCATCCGTTACAGTCG,  downstream forward: _UP4_TAACAAAAAAATGACAAATA
References
19651770,17449691

8FE909876A7A21B436CA0CFB90ED190BAD17C8E1

Page visits: 1340

Time of last update: 2022-05-25 19:39:26

Author of last update: Bzhu