codY

codY
168

regulation of a large regulon (more than 100 genes and operons) in response to branched-chain amino acid limitation

locus
BSU_16170
Molecular weight
28.86 kDa
pI
4.75
Protein length
Gene length
function
regulation of a large regulon in response to branched-chain amino acid limitation
product
transcriptional pleiotropic repressor
essential
no
synonyms
codY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4465

This gene is a member of the following regulons

Gene
Coordinates
1,690,119  1,690,898
Phenotypes of a mutant
no swarming motility on B medium. [Pubmed|19202088]
the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' suppresses the requirement of a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant for branched chain amino acids, methionine and threonine [Pubmed|24163341]
The protein
Protein family
codY family (single member, according to UniProt)
[wiki|Domains]
contains a GAF domain (ligand binding domain)
Structure
[PDB|5LOO] (unliganded full-length protein) [Pubmed|28011634]
[PDB|2B0L] (C-terminal DNA-binding domain),  [PDB|2GX5] (N-terminal Gaf domain)
[AF|P39779]
Modification
phosphorylation on Ser-215 [Pubmed|17218307]
Effectors of protein activity
GTP and branched chained amino acids (BCAA) increase the affinity of CodY for its DNA target sequences [Pubmed|11331605,15228537,21856856]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|B6062575849EA65BB7B44A9723676885799E2759|trmFO]-[gene|89746E312F20C81BE3CFDFCE7D99B01C375C198B|codV]-[gene|F6B748621B312E0B5A0A0782F3944C3E8112D7A8|clpQ]-[gene|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY]-[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]
description
[Pubmed|22383849]
regulation
repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|11331605]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|11331605], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7783641], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the intracellular concentration of CodY is about 2.5 myM (according to [PubMed|20408793])
Open in new tab

[gene|B6062575849EA65BB7B44A9723676885799E2759|trmFO]→[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]

2022-12-03 11:15:54

Jstuelk

40

14a27ac38158bfce7849c72f786e8673bc2ce6b1

5257B6B5AFCAE25607CF5DD2E50F759EF0225538

Biological materials
Mutant
GP566 available in [wiki|Jörg Stülke]'s lab
GP2473 (Δ[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::spec), available in [wiki|Jörg Stülke]'s lab
GP3453 (Δ[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::phleo), available in [wiki|Jörg Stülke]'s lab
GP3454 (Δ[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::cat), available in [wiki|Jörg Stülke]'s lab
a ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::erm'' mutant is available in [wiki|Linc Sonenshein]'s lab
a ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::spc'' (BB1043) mutant is available in [wiki|Linc Sonenshein]'s, [wiki|Fabian Commichau]'s and [wiki|Jörg Stülke]'s labs
BKE16170 ([gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATAAATAATCCTCCTA,  downstream forward: _UP4_TAATCACAAAAAGAACCCTT
BKK16170 ([gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATAAATAATCCTCCTA,  downstream forward: _UP4_TAATCACAAAAAGAACCCTT
Expression vectors
pGP244 (for expression, purification in ''E. coli'' with Thrombin-cleavable N-terminal His-tag, in [wiki|pWH844]),  available in [wiki|Jörg Stülke]'s lab
pBP616 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP380]) (available in [wiki|Fabian Commichau]'s lab)
pBP618 (C-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP382]) (available in [wiki|Fabian Commichau]'s lab)
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Fabian Commichau]'s lab
labs
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
[wiki|Tony Wilkinson], York University, U.K. [http://www.york.ac.uk/depts/chem/staff/ajw.html Homepage]
[wiki|Oscar Kuipers], University of Groningen, The Netherlands, [http://molgen.biol.rug.nl/molgen/index.php Homepage]
References
Reviews
15802253,17982469,20408793,24462007
Original Publications
19542274,17493123,18641142,19202088,16995897,17993518,9287005,11331605,17218307,19500589,12591885,19202088,11331605,15228537,8793880,26170408,15937175,15916605,15916606,11331605,15228537,19749041,7783641,20935095,21097623,21699902,21764931,22981860,22512862,21856856,23911932,24296669,24163341,25157083,25645558,24682323,25666135,25966844,26220295,26473603,26728191,27596595,28011634,28371347,30096425,16488888,36372802
The [wiki|CodY regulon]
18083814,12618455,23569278,24843172,31944451

90ACE0DECA58D3C1A55E135120F7A0C1C920571C

Page visits: 8627

Time of last update: 2022-12-08 00:36:55

Author of last update: Jstuelk