ymzE/1

ymzE/1
168

part of the ymzE pseudogene

locus
BSU_17266
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
ymzE/1
Outlinks

Genomic Context

Categories containing this gene/protein

This gene is a member of the following regulons

Biological materials
Mutant
BKE17266 (Δ[gene|90DE91A491CAE1B32462D1829CF063D1FB2A65F2|ymzE/1]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17266 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGGTTGCTCTCCCCTT,  downstream forward: _UP4_AGCCAAATGCCAATCAGCAT
BKK17266 (Δ[gene|90DE91A491CAE1B32462D1829CF063D1FB2A65F2|ymzE/1]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17266 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGGTTGCTCTCCCCTT,  downstream forward: _UP4_AGCCAAATGCCAATCAGCAT

90DE91A491CAE1B32462D1829CF063D1FB2A65F2

Page visits: 406

Time of last update: 2022-11-28 18:47:09

Author of last update: Bzhu