ntdR

ntdR
168

transcription activator of the [gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]-[gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]-[gene|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC]-[gene|search|glcP ]operon

locus
BSU_10560
Molecular weight
37.53 kDa
pI
6.64
Protein length
Gene length
function
regulation of the [gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]-[gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]-[gene|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC]-[gene|search|glcP ]operon
product
transcriptional regulator ([wiki|LacI family])
essential
no
synonyms
ntdR, yhjM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1609

This gene is a member of the following regulons

Gene
Coordinates
1,129,715  1,130,704
The protein
Catalyzed reaction/ biological activity
transcription activation of the ''[gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]-[gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]-[gene|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC]-[gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]'' operon [Pubmed|17056753]
Protein family
[wiki|LacI family]
[wiki|Domains]
[wiki|HTH lacI-type domain] (aa 2-56) (according to UniProt)
Structure
[PDB|2HSG] ([protein|search|ccpA ]from B. megaterium, 31% identity) [pubmed|17500051]
[AF|O07567]
Expression and Regulation
Operons
genes
[gene|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR]
description
[Pubmed|14612444]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR]

2022-11-28 02:54:04

ghost

11

ddb3998a89db3f3508cf43feff564cc59bafa3a2

5146A3137E81E1583CFC63A1961870F3E72CB1CD

Biological materials
Mutant
MGNA-A726 (yhjM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/726 NBRP B. subtilis, Japan]
BKE10560 ([gene|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCCTTCCTTAAA,  downstream forward: _UP4_TAACGATAGATTTCCCTTTA
BKK10560 ([gene|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCCTTCCTTAAA,  downstream forward: _UP4_TAACGATAGATTTCCCTTTA
References
Reviews
21512256
Original Publications
14612444,20817675,17056753

9118A36CD30E7C99697B3659BB04E03BB7EE71D7

Page visits: 1694

Time of last update: 2022-11-30 01:45:35

Author of last update: Melvin.boenninger