SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


modulates assembly of the [protein|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]-[protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]-[protein|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ] [wiki|ABC transporter] for the export of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin

Molecular weight
24.03 kDa
Protein length
Gene length
resistence against [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin
modulator of [wiki|ABC transporter] assembly

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

1,503,582  1,504,277
The protein
cell membrane (according to UniProt),  membrane [Pubmed|18763711]
Expression and Regulation
Open in new tab


2022-01-24 11:57:43





repressed during logrithmic growth ([protein|search|AbrB]) [Pubmed|12076816]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12076816], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab


2021-11-16 05:55:10





Biological materials
MGNA-B348 (yknW::erm), available at the [ NBRP B. subtilis, Japan]
BKE14340 ([gene|916419C4ED113778488EBC558A35810498028B02|yknW]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCAAAACCTCCTTGAG,  downstream forward: _UP4_AATTCTGTGGCGGGTGCATA
BKK14340 ([gene|916419C4ED113778488EBC558A35810498028B02|yknW]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCAAAACCTCCTTGAG,  downstream forward: _UP4_AATTCTGTGGCGGGTGCATA


Page visits: 1790

Time of last update: 2022-01-25 08:41:25

Author of last update: Jstuelk