yknW

yknW
168

modulates assembly of the [protein|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]-[protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]-[protein|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ] [wiki|ABC transporter] for the export of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin

locus
BSU_14340
Molecular weight
24.03 kDa
pI
6.94
Protein length
Gene length
function
resistence against [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin
product
modulator of [wiki|ABC transporter] assembly
essential
no
ec
null
synonyms
yknW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,503,582  1,504,277
The protein
Structure
[AF|O31709]
[wiki|Localization]
cell membrane (according to UniProt),  membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU]-[gene|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|yknV]-[gene|916419C4ED113778488EBC558A35810498028B02|yknW]-[gene|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]-[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]-[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]
description
[Pubmed|22383849]
Open in new tab

[gene|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU]→[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]

2022-11-29 08:51:40

Jstuelk

20

974e58c669e1cd698f882bd9e9cd9cf65b440ca0

2DDBCA4C4ACA22DB6536DC6ACAC265E497334729

genes
[gene|916419C4ED113778488EBC558A35810498028B02|yknW]-[gene|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]-[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]-[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]
description
[Pubmed|9987136]
regulation
repressed during logrithmic growth ([protein|search|AbrB]) [Pubmed|12076816]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12076816], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab

[gene|916419C4ED113778488EBC558A35810498028B02|yknW]→[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]

2022-11-22 16:03:56

ghost

25

8e304f408425d6f34ae03472458263e5418cf4c1

6245A3EE9A735006B93C2157E2EB2D4ED6006306

Biological materials
Mutant
MGNA-B348 (yknW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1347 NBRP B. subtilis, Japan]
BKE14340 ([gene|916419C4ED113778488EBC558A35810498028B02|yknW]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCAAAACCTCCTTGAG,  downstream forward: _UP4_AATTCTGTGGCGGGTGCATA
BKK14340 ([gene|916419C4ED113778488EBC558A35810498028B02|yknW]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCAAAACCTCCTTGAG,  downstream forward: _UP4_AATTCTGTGGCGGGTGCATA
References
16629676,12076816,18763711,9987136

916419C4ED113778488EBC558A35810498028B02

Page visits: 2257

Time of last update: 2022-12-01 09:10:12

Author of last update: Jstuelk