gpr

gpr
168

germination protease (degradation of SASPs)

locus
BSU_25540
Molecular weight
40.12 kDa
pI
5.2
Protein length
Gene length
function
degradation of SASPs
product
germination protease (degradation of SASPs)
essential
no
synonyms
gpr

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5911

This gene is a member of the following regulons

Gene
Coordinates
2,634,505  2,635,611
The protein
Catalyzed reaction/ biological activity
degradation of small, acid-soluble spore proteins (SASPs) [Pubmed|8478323]
Endopeptidase action with P4 Glu or Asp, P1 preferably Glu > Asp, P1' hydrophobic and P2' Ala (according to UniProt)
Protein family
peptidase A25 family (single member, according to UniProt)
Structure
[PDB|1C8B] (from B. megaterium, 68% identity) [pubmed|10864493]
[AF|P22322]
[wiki|Localization]
inner spore membrane [Pubmed|26731423]
Expression and Regulation
Operons
genes
[gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]-[gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF], [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG], [wiki|SpoVT]) [Pubmed|16497325,1840582]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|16497325], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325,1840582], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|1840582], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]→[gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]

2023-02-01 13:38:15

Jstuelk

38

76a8c0a73904216fb84776d2606465c8bd587731

DC8A669EDBB0F070BE63D7364C4DD18943FA2867

Biological materials
Mutant
BKE25540 ([gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAGGGGCCTCCTTCAC,  downstream forward: _UP4_TAAACAGTTCTACTTCCTCT
BKK25540 ([gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAGGGGCCTCCTTCAC,  downstream forward: _UP4_TAAACAGTTCTACTTCCTCT
References
16199582,9045848,8188581,8071242,1732215,16497325,7961468,8071212,9748439,1840582,7608092,8478323,23927687,26731423,10864493,35638784

91C5AF928EB8E00F12D1BC0E788E1CB116F87B04

Page visits: 2315

Time of last update: 2023-02-06 20:40:38

Author of last update: Jstuelk