SubtiWiki SubtiWiki
yqxC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yqxC
168

similar to rRNA methyltransferase

locus
BSU_24260
Molecular weight
29.50 kDa
pI
10.11
Protein length
Gene length
function
unknown
product
putative rRNA methyltransferase
essential
no
synonyms
yqxC, yqiF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1189

This gene is a member of the following regulons

Gene
Coordinates
2,522,871  2,523,716
The protein
Protein family
[wiki|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
TlyA family (single member, according to UniProt)
[wiki|Domains]
[wiki|S4 RNA-binding domain] (aa 6-67) (according to UniProt)
[wiki|Cofactors]
SAM [pubmed|28031456]
Structure
[PDB|3HP7] (from Streptococcus thermophilus, 60% identity)
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]
description
[Pubmed|2507400]
additional information
the terminator is [protein|search|NusA]-dependent [ http://www.nature.com/articles/nmicrobiol20157 Reference]
Open in new tab

[gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]

2021-11-14 13:21:46

ghost

6

d1b303d85ff5abb1ddd98c28d7e82caea6cdabea

A98F5CF05B32FBE697D9E1608106FAFB3D6A1277

genes
[gene|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|dxs]-[gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]-[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]-[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]
description
[pubmed|22383849]
regulation
[protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
regulatory mechanism
stringent response: negative regulation, [pubmed|11948165], in [regulon|other_regulator:stringent response|stringent response]
Open in new tab

[gene|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|dxs]->[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]

2021-12-24 03:52:56

Bzhu

12

b0947a7d3105a0852956b3f944c4db191022c978

B8B8483360C3BE8FDAC3C4C5B3BC2ECD2877E42D

Biological materials
Mutant
MGNA-C369 (yqxC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2367 NBRP B. subtilis, Japan]
BKE24260 ([gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCTAATCGTTCTTTCTTTG,  downstream forward: _UP4_TAATAGGGCGCTATTATTCC
BKK24260 ([gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCTAATCGTTCTTTCTTTG,  downstream forward: _UP4_TAATAGGGCGCTATTATTCC
References
2507400,28031456,20854656,21443791

923C4177500E9678A0B4855F8F481D4A36ECD863

Page visits: 1149

Time of last update: 2022-01-20 08:33:17

Author of last update: Melvin.boenninger