gutR

gutR
168

transcription activator of the gutB-gutP operon

locus
BSU_06140
Molecular weight
94.88 kDa
pI
6.11
Protein length
Gene length
function
regulation of glucitol utilization
product
transcription activator
essential
no
synonyms
gutR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0457

This gene is a member of the following regulons

Gene
Coordinates
664,775  667,264
The protein
[wiki|Domains]
three [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[AF|P39143]
Expression and Regulation
Operons
genes
[gene|926BCA197F259558F72FDCC73998497B9B167D22|gutR]
description
[Pubmed|12897001]
Open in new tab

[gene|926BCA197F259558F72FDCC73998497B9B167D22|gutR]

2023-02-03 16:05:05

ghost

17

cc4d56d5ed5aad1c78c0b41dd88522b586873801

C2A707A672CC8888A23FB8D78F7DC60C3FB96B42

Biological materials
Mutant
BKE06140 ([gene|926BCA197F259558F72FDCC73998497B9B167D22|gutR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCTGCACCTCCTAT,  downstream forward: _UP4_TAGTACGTAGTTCTGTCAGC
BKK06140 ([gene|926BCA197F259558F72FDCC73998497B9B167D22|gutR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCTGCACCTCCTAT,  downstream forward: _UP4_TAGTACGTAGTTCTGTCAGC
References
11390381,8195087,8195086,11118449,12897001

926BCA197F259558F72FDCC73998497B9B167D22

Page visits: 2282

Time of last update: 2023-02-07 14:42:54

Author of last update: Jstuelk