sleB

sleB
168

spore cortex-lytic enzyme

locus
BSU_22930
Molecular weight
33.85 kDa
pI
9.51
Protein length
Gene length
function
degration of the spore cortex, [wiki|germination]
product
spore cortex-lytic enzyme
essential
no
synonyms
sleB, ypeA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3773

This gene is a member of the following regulons

Gene
Coordinates
2,399,152  2,400,069
The protein
Protein family
sleB family (single member, according to UniProt)
[wiki|Domains]
contains a signal peptide [Pubmed|23335419]
Structure
[PDB|4FET] (from B. anthracis, 50% identity) [pubmed|22777830]
[AF|P50739]
[wiki|Localization]
outer surface of the inner spore membrane [Pubmed|23335419]
Expression and Regulation
Operons
genes
[gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]-[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]
description
[Pubmed|15699190,10197998]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,10197998]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,10197998], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]→[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]

2022-12-29 23:08:09

ghost

30

5d74caf239944fb1e30c0e6238601bcbb30b2316

2938A80B9758C9FA23B7F1A8D1FA5325A1915AE5

Biological materials
Mutant
MGNA-A399 (sleB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/399 NBRP B. subtilis, Japan]
1G21 ( ''sleB''::''spec''), [Pubmed|11466292], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1G21&Search=1G21 BGSC]
BKE22930 ([gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCAAGCCTCCTAC,  downstream forward: _UP4_TAGCAGATATGAGAAAGCAT
BKK22930 ([gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCAAGCCTCCTAC,  downstream forward: _UP4_TAGCAGATATGAGAAAGCAT
References
16905870,16707666,10197998,25963559,20435722,23335419,23543708,23746146,12177332,10658652,26187959,26731423,22777830,31871031,35638784

92E50EF57FFCB22563B3C3A73B0885CCED8E9692

Page visits: 3248

Time of last update: 2023-02-05 02:52:33

Author of last update: Jstuelk