cdaS

cdaS
168

sporulation-specific diadenylate cyclase, synthesis of c-di-AMP

locus
BSU_19430
Molecular weight
22.75 kDa
pI
5.37
Protein length
Gene length
function
synthesis of c-di-AMP
product
sporulation-specific diadenylate cyclase
essential
no
ec
2.7.7.85
synonyms
cdaS, yojJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1624

This gene is a member of the following regulons

Gene
Coordinates
2,118,504  2,119,127
Phenotypes of a mutant
a [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]
2 ATP --> 3',3'-c-di-AMP + 2 diphosphate (according to UniProt)
Protein family
adenylate cyclase family (with [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA], according to UniProt)
[wiki|Domains]
N-terminal autoinhibitory domain [Pubmed|24939848]
C-terminal [wiki|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]
[wiki|DAC domain] (aa 63-205) (according to UniProt)
Structure
[PDB|2FB5] (the protein of ''B. cereus'', 48% identity, 81% similarity)
[AF|O31854]
Paralogous protein(s)
[protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]
Expression and Regulation
Operons
genes
[gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]
description
[Pubmed|22383849]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|22383849]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|22383849], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]

2023-01-08 09:17:09

ghost

23

46d5e4f41e0502899ea5aac5e84f0abec559ef9c

CE713202908833B1D3A579A1C3A2C86E345877E9

Biological materials
Mutant
MGNA-B426 (yojJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1425 NBRP B. subtilis, Japan]
GP983 (''[gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]''::''ermC''), available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
GP1360 (''[gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]''::''spc''), available in [wiki|Jörg Stülke]'s lab
GP2222 ([gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::ermC ''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''tet''), available in [wiki|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
BKE19430 ([gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCCTGTTTAAATTTCC,  downstream forward: _UP4_TAAAAATAATAAAAAGGGCC
BKK19430 ([gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCCTGTTTAAATTTCC,  downstream forward: _UP4_TAAAAATAATAAAAAGGGCC
Expression vectors
IPTG inducible expression of '''''B. cereus''''' Strep-''cdaS'' in ''E. coli'': pGP2593 (in [wiki|pGP172]), available in [wiki|Jörg Stülke]'s lab
IPTG inducible expression of His-''cdaS'' in ''E. coli'': pGP1972 (in pET19B), available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
labs
[wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
References
Reviews
25869574,18714086,23812326,30224435,32472931,32603625
Original Publications
21566650,23192352,22383849,24939848,26441857

92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32

Page visits: 2512

Time of last update: 2023-02-05 16:41:37

Author of last update: Jstuelk