folEB

folEB
168

GTP cyclohydrolase IB, required for the initial step of queuosine synthesis ([wiki|tRNA modification]), replaces [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|folE] under conditions of zinc starvation

locus
BSU_03340
Molecular weight
34.63 kDa
pI
7.83
Protein length
Gene length
function
biosynthesis of folate and queuosine
product
zinc-independent GTP cyclohydrolase IB
essential
no
ec
3.5.4.16
synonyms
folEB, folE2, yciA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1469

This gene is a member of the following regulons

Gene
Coordinates
364,259 → 365,173
The protein
Catalyzed reaction/ biological activity
GTP + H2O --> 7,8-dihydroneopterin 3'-triphosphate + formate + H+ (according to UniProt)
Protein family
GTP cyclohydrolase IV family (single member, according to UniProt)
[wiki|Cofactors]
activated by a variety of divalent cations [Pubmed|19767425]
Structure
[PDB|3D1T] [Pubmed|19767425]
[AF|P94398]
Expression and Regulation
Operons
genes
[gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]-[gene|456AF184261976FAA73359E81443F7035F457D07|yciB]-[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
description
[Pubmed|9811636]
regulation
[wiki|folE2]: induced by zinc starvation ([protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]) [Pubmed|12426338]
regulatory mechanism
[protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|protein:A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12426338], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]→[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]

2022-09-14 02:22:42

Jstuelk

32

ad7d4075bafccef586e192b5f9b59ca4750bd357

154D780A688DFF455944F618E9A71FDF4E6BA39E

Biological materials
Mutant
BKE03340 (Δ[gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAGAAAACTCCTCTCA,  downstream forward: _UP4_TTTTCGAAGGAAGTGGATAA
BKK03340 (Δ[gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAGAAAACTCCTCTCA,  downstream forward: _UP4_TTTTCGAAGGAAGTGGATAA
References
9811636,12426338,17032654,19767425,27561249

93380E8EEB672C14C9BE2B5A6D8573FBCA149514

Page visits: 1677

Time of last update: 2022-10-03 21:47:29

Author of last update: Jstuelk