SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


required for membrane localization of [protein|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI] and [protein|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA] upon stress

Molecular weight
28.01 kDa
Protein length
Gene length
targeting of [protein|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1512

This gene is a member of the following regulons

673,019  673,783
Phenotypes of a mutant
strong defect in cell morphology upon alkali stress [pubmed|34777311]
The protein
Protein family
UPF0603 family (single member, according to UniProt)
cell membrane [pubmed|34777311]
Expression and Regulation
induced by alkaline shock ([protein|search|SigW]) [Pubmed|11454200]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696,20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11454200], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab


2022-01-22 17:17:51





Biological materials
MGNA-C215 (ydjH::erm), available at the [ NBRP B. subtilis, Japan]
BKE06200 ([gene|938B55332DFB2B465D0D5AD530550CED5AC30A92|ydjH]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCTTTCCCAAAAAATCCAC,  downstream forward: _UP4_TAAATGTAAGAAATAGAGAA
BKK06200 ([gene|938B55332DFB2B465D0D5AD530550CED5AC30A92|ydjH]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCTTTCCCAAAAAATCCAC,  downstream forward: _UP4_TAAATGTAAGAAATAGAGAA


Page visits: 1263

Time of last update: 2022-01-22 05:57:49

Author of last update: Jstuelk