ybfB

ybfB
168

putative transporter

locus
BSU_02170
Molecular weight
45.08 kDa
pI
9.57
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ybfB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2271

This gene is a member of the following regulons

Gene
Coordinates
236,879  238,129
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|O31444]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]-[gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]-[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]
description
[Pubmed|22383849]
Open in new tab

[gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]→[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]

2022-10-23 03:34:30

Jstuelk

7

1afc5a31aeaa2255359589aa12a176cd49ea7172

3F7981DE9DCD035C47FD3E3F5BD5AAFABA36FBEE

genes
[gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]-[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]
description
[Pubmed|22383849]
Open in new tab

[gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]→[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]

2022-12-02 04:44:52

Jstuelk

14

848873d507d2304f32f5369e6858db2d73aa05a7

5F9B16191C0A3430E86B3DB70ABB2FB8F9B51B93

Biological materials
Mutant
MGNA-B965 (ybfB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1964 NBRP B. subtilis, Japan]
BKE02170 ([gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATGACAGCTCCAAATC,  downstream forward: _UP4_TGATGAGGACAAAGGGAAAG
BKK02170 ([gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATGACAGCTCCAAATC,  downstream forward: _UP4_TGATGAGGACAAAGGGAAAG

93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3

Page visits: 945

Time of last update: 2022-12-04 17:57:22

Author of last update: Jstuelk