SubtiWiki SubtiWiki
iolG

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

iolG
168

inositol 2-dehydrogenase

locus
BSU_39700
Molecular weight
38.20 kDa
pI
4.86
Protein length
Gene length
function
myo-inositol catabolism
product
inositol 2-dehydrogenase
essential
no
ec
1.1.1.18
synonyms
iolG, idh, iol

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0673

This gene is a member of the following regulons

Gene
Coordinates
4,075,785  4,076,819
The protein
Catalyzed reaction/ biological activity
myo-inositol + NAD+ --> H+ + NADH + scyllo-inosose (according to UniProt)
1D-chiro-inositol + NAD+ --> H+ + NADH + scyllo-inosine (according to UniProt)
Protein family
[wiki|Gfo/Idh/MocA family] (according to UniProt)
[wiki|Cofactors]
NAD+ [Pubmed|20809899]
Structure
[PDB|3MZ0] [Pubmed|20809899]
Paralogous protein(s)
[protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|yrbE], [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX], [protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT], [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|iolW], [protein|920C5750CB95102B073C32874D512E8D636D2C7D|iolU]
Expression and Regulation
Operons
genes
[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
description
[Pubmed|9226270]
regulation
induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
regulatory mechanism
[protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]: repression, [Pubmed|9887260,9226270], in [regulon|protein:5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9226270], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]→[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]

2021-11-10 21:13:09

ghost

10

4fd092965338ef1511600132442d2247a2693c98

C19E63046F0B412961D2626F72E0308D922D50B2

Biological materials
Mutant
MGNA-B698 (iolG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1697 NBRP B. subtilis, Japan]
BKE39700 ([gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGACAGCCACTCCTTCT,  downstream forward: _UP4_AACTAAAAAACAGAGGAGTG
BKK39700 ([gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGACAGCCACTCCTTCT,  downstream forward: _UP4_AACTAAAAAACAGAGGAGTG
labs
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
[[Ken-ichi Yoshida]], Kobe University, Japan
References
9226270,6322857,1761221,112095,9887260,18310071,112095,20809899,23952058,24325193,25019153

93C1DF93CAFC5AE726523A91A3BA7470017FF6DC

Page visits: 2066

Time of last update: 2022-01-19 11:21:42

Author of last update: Melvin.boenninger