gerBC

gerBC
168

lipoprotein, nutrient receptor, germination response to the combination of glucose, fructose, and KCl

locus
BSU_35820
Molecular weight
42.31 kDa
pI
9.06
Protein length
Gene length
function
germination
product
nutrient receptor
essential
no
synonyms
gerBC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5903

This gene is a member of the following regulons

Gene
Coordinates
3,691,372  3,692,496
The protein
Protein family
[wiki|GerABKC lipoprotein family] (according to UniProt)
[wiki|Domains]
has an N-terminal signal sequence, lipidated on a Cys residue adjacent to the signal peptide [Pubmed|23335419]
Structure
[PDB|3N54] [Pubmed|20654628]
[AF|P39571]
Paralogous protein(s)
[protein|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|gerAC]
[wiki|Localization]
outer surface of the inner spore membrane [Pubmed|23335419,21685283]
Additional information
700 molecules are present per spore [Pubmed|23749970]
Expression and Regulation
Operons
genes
[gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]-[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]-[gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]
description
[Pubmed|8012571]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,8012571]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,8012571], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
additional information
700 molecules are present per spore [PubMed|23749970]
Open in new tab

[gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]→[gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]

2022-12-01 12:08:23

ghost

22

11403d1061e669b27b23e28630f92c3f61532965

BDB4DB82BD783DEB3DA0C1C26208AF22202AD946

Biological materials
Mutant
BKE35820 ([gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35820 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GACGGAGAATTTTGATGCTG,  downstream forward: _UP4_TAAGCAATCAAAAGGGTGCG
BKK35820 ([gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35820 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GACGGAGAATTTTGATGCTG,  downstream forward: _UP4_TAAGCAATCAAAAGGGTGCG
References
23396907,16740944,23749970,24752279,7812448,12670969,15774895,15699190,8012571,16352818,20654628,21685283,21696470,22493018,23335419,26731423

93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3

Page visits: 2077

Time of last update: 2022-12-08 09:40:48

Author of last update: Melvin.boenninger