ymzA

ymzA
168

unknown

locus
BSU_17360
Molecular weight
8.55 kDa
pI
4.35
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ymzA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,868,144  1,868,374
The protein
Structure
[AF|O31798]
Expression and Regulation
Operons
genes
[gene|93FA602438546FD6201FAB5BD19DB5DEB5965E48|ymzA]-[gene|1EA0595C74359A36B9161CFD531CA894C5E66E25|nrdI]-[gene|3B68CE8E9A35997B45E437A316996D585E43B76B|nrdE]-[gene|CD2D14FE9C10544E7C350167EBDBD941B898051D|nrdF]-[gene|8C2A08A8395B72CCC9D03A8154602B8F3B77A1AA|ymaB]
description
[Pubmed|22383849]
Open in new tab

[gene|93FA602438546FD6201FAB5BD19DB5DEB5965E48|ymzA]→[gene|8C2A08A8395B72CCC9D03A8154602B8F3B77A1AA|ymaB]

2022-12-06 07:18:11

Jstuelk

39

c327eefb1356b60d6946dc8bb1110dce66ded764

3940914A8E31A6E8EACC40EBB2BDE0A966EB921D

genes
[gene|93FA602438546FD6201FAB5BD19DB5DEB5965E48|ymzA]
description
[Pubmed|22383849]
Open in new tab

[gene|93FA602438546FD6201FAB5BD19DB5DEB5965E48|ymzA]

2022-12-07 16:58:49

Jstuelk

11

3dd0255071cf5689684061cceb5f689219db4749

FEF905541128B8DA6B4C6CEB16BA862E07252087

Biological materials
Mutant
MGNA-B102 (ymzA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1101 NBRP B. subtilis, Japan]
BKE17360 ([gene|93FA602438546FD6201FAB5BD19DB5DEB5965E48|ymzA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCACCCTCTGTTT,  downstream forward: _UP4_TAAGCAGTTTTTTTTCATGT
BKK17360 ([gene|93FA602438546FD6201FAB5BD19DB5DEB5965E48|ymzA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCACCCTCTGTTT,  downstream forward: _UP4_TAAGCAGTTTTTTTTCATGT
References
20525796

93FA602438546FD6201FAB5BD19DB5DEB5965E48

Page visits: 1228

Time of last update: 2022-12-08 07:04:04

Author of last update: Bzhu