aprX

aprX
168

intracellular alkaline serine protease

locus
BSU_17260
Molecular weight
47.74 kDa
pI
4.97
Protein length
Gene length
function
protein degradation
product
intracellular alkaline serine protease
essential
no
synonyms
aprX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1404

This gene is a member of the following regulons

Gene
Coordinates
1,861,384  1,862,712
The protein
Protein family
[wiki|peptidase S8 family] (according to UniProt)
[wiki|Domains]
[wiki|Peptidase S8 domain] (aa 122-439) (according to UniProt)
Structure
[PDB|3WHI] ([protein|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE], corresponds to aa 78 ... 436, 33% identity) [pubmed|24279884]
[AF|O31788]
Expression and Regulation
Operons
genes
[gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]
description
[Pubmed|22383849]
regulation
induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]) [Pubmed|16267290]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10589719], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]

2022-11-29 20:49:07

Jstuelk

53

31d056fdbc6d6278981e708ff8be8d60f025b0fb

C80B550023CBA5C0D32374396F9A0E306850B8E0

Biological materials
Mutant
MGNA-A019 (aprX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/19 NBRP B. subtilis, Japan]
BKE17260 ([gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATTTTCCTCCTATTA,  downstream forward: _UP4_TAAACATCATCAAAAGCCGG
BKK17260 ([gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATTTTCCTCCTATTA,  downstream forward: _UP4_TAAACATCATCAAAAGCCGG
References
Reviews
34410368
Original Publications
10589719,16267290,24279884
Labs working on this gene/protein
[wiki|Alessandra Albertini], University of Pavia, Italy [http://www-1.unipv.it/genbiom/albertini.html homepage]

945A1332A020CF842DA590589C88C758DE65C84E

Page visits: 2042

Time of last update: 2022-12-01 02:54:00

Author of last update: Jstuelk