pdhA

pdhA
168

pyruvate dehydrogenase (E1 alpha subunit), required for Z-ring assembly in a pyruvate-dependent manner

locus
BSU_14580
Molecular weight
41.39 kDa
pI
5.84
Protein length
Gene length
function
links glycolysis and TCA cycle
product
pyruvate dehydrogenase (E1 alpha subunit)
essential
no
ec
1.2.4.1
synonyms
pdhA, aceA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1071

This gene is a member of the following regulons

Gene
Coordinates
1,528,326 1,529,441
Phenotypes of a mutant
''pdhA'' is essential according to Kobayashi ''et al''. [Pubmed|12682299], non-essential according to [Pubmed|28189581]
the mutant grows slowly but is viable [Pubmed|24825009]
depletion of [gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA] and deletion of [gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA] have a strong synthetic defect in [wiki|cell division] [Pubmed|24825009]
The protein
Catalyzed reaction/ biological activity
[dihydrolipoyllysine-residue acetyltransferase]-(R)-N6-lipoyl-L-lysine + H+ + pyruvate --> [dihydrolipoyllysine-residue acetyltransferase]-(R)-N6-(S8-acetyldihydrolipoyl)-L-lysine + CO2 (according to UniProt)
[wiki|Cofactors]
thiamine pyrophosphate
Structure
[PDB|1W88] (E1 in complex with subunit binding domain of E2, ''Geobacillus stearothermophilus'')
[AF|P21881]
Effectors of protein activity
Inhibited thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
Low sensibility to NADPH
Kinetic information
Michaelis-Menten [Pubmed|6414463]
Paralogous protein(s)
[protein|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA], [protein|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]
[wiki|Localization]
colocalizes with the nucleoid (depending on the availability of pyruvate) [Pubmed|24825009]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]-[gene|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|pdhB]-[gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]-[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]
description
[Pubmed|11976308]
regulation
''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
regulatory mechanism
stringent response: negative regulation, due to presence of guanine at 1 position of the transcript [Pubmed|20081037], in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20081037], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]→[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]

2022-05-25 21:55:04

ghost

19

797fea7dcbe4317f63eb94d44165272d12ff3ae4

3D5EA61F84C1F6538A394D4F9A00FD4029ED115F

Biological materials
Mutant
BKE14580 ([gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTAAGTCACCTCTTCC, downstream forward: _UP4_ACACAGAAGGAGTCGAAGTA
BKK14580 ([gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTAAGTCACCTCTTCC, downstream forward: _UP4_ACACAGAAGGAGTCGAAGTA
lacZ fusion
pGP721 (in [wiki|pAC5]), available in [wiki|Jrg Stlke]'s lab, pGP186 (in [wiki|pAC7]), available in [wiki|Jrg Stlke]'s lab
labs
[wiki|Arthur Aronson], Purdue University, West Lafayette, USA [http://wwwdev.gradschool.purdue.edu/PULSe/faculty.cfm?fid=5&range=0 homepage]
References
Reviews
19476487,9655937,2227213,6805383,24798336
Original Publications
9352926,20525796,12850135,6414463,11976308,20081037,15378759,24825009,28189581,28516784,30782632

953DE0F0B81894ECFF4C0693511AC238BF3D0C0A

Page visits: 4395

Time of last update: 2022-06-24 03:42:43

Author of last update: Jstuelk