comEB

comEB
168

dCMP deaminase, late competence protein, nucleotide scavenging protein for efficient reutilization of the products of degradation of the non-transforming strand during DNA uptake

locus
BSU_25580
Molecular weight
20.82 kDa
pI
5.37
Protein length
Gene length
function
nucleotide scavenging
product
dCMP deaminase
essential
no
synonyms
comEB, comD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2131

This gene is a member of the following regulons

Gene
Coordinates
2,639,877  2,640,446
The protein
Catalyzed reaction/ biological activity
deoxycytidylate monophosphate (dCMP) deaminase [pubmed|31954084]
nucleotide scavenging protein for efficient reutilization of the products of degradation of the non-transforming strand during DNA uptake [pubmed|33527432]
Protein family
[wiki|Cytidine and deoxycytidylate deaminase family] (according to UniProt)
[wiki|Domains]
[wiki|CMP/dCMP-type deaminase domain] (aa 5–132) (according to UniProt)
Structure
[PDB|2HVV] (from Streptococcus mutans, 50% identity) [pubmed|18255096]
[AF|P32393]
[wiki|Localization]
localizes to one or both cell poles [Pubmed|31954084,21278288]
Expression and Regulation
Operons
genes
[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]-[gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]-[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]
description
[Pubmed|7968523,19028902]
regulatory mechanism
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, [Pubmed|8196543], in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7968523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]→[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]

2023-01-02 06:00:32

ghost

42

86f3e687bb54836ace615fef7894da50ba4cc85a

45A6B709534D0EE24B7E982999D607F68BD6A18E

Other regulations
[protein|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|comN]: unknown, [pubmed|19028902]
Biological materials
Mutant
BKE25580 ([gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG,  downstream forward: _UP4_CTTTTCACGAGCTACGTGTG
BKK25580 ([gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG,  downstream forward: _UP4_CTTTTCACGAGCTACGTGTG
References
11814663,7968523,21278288,19028902,18255096,31954084,33527432

954359717E15DFC106A9D8111C6637E46B16F8C9

Page visits: 3289

Time of last update: 2023-02-07 14:50:52

Author of last update: Jstuelk